Apenes marginalis

(Dejean, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Apenes

At a glance

Occurrence records48

Data sources5

Biological traits0

DNA specimens13

eDNA detections12

Sources5 archives

Databases and archives Apenes marginalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD13 specimens

01Narrative

Apenes marginalis is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1831 door Dejean.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apenes marginalis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections12

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGAGCATGAGCTGGAATAGTAGGAACATCATTAAGAATATTAATTCGAGCTGAATTAGGAAATCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apenes portoricensissame genus4.9%Apenes lucidulasame genus6.5%Apenes variegatasame genus6.6%Apenes ivieisame genus7.8%Amara convexiorsame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type48 records

Wild obs. + sensor24

Museum / vouchered24

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 14≤10 km 1>10 km 9

24 georeferenced

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 14

14 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	11
OSUClocation not on record	8
University of Alberta Museums (UAM)location not on record	1
Mayagüez, PR	1

4 institutions · 21 of 24 vouchered records shown · 3 without an institution code

09Environmental DNA12 detections

Where the DNA of Apenes marginalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

grasslandHerbaceousDry tropical forestSemi-decidous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 26.4–27.6

Seasonal swing summer↔winter2.80 °C

Max temp (day)29.4 °C 27.4–30.0

Min temp (night)25.6 °C 24.4–25.7

Precipitation194 mm/mo 133–269

Air humidity62.4 % 60.8–66.5

Moisture balance10.7 mm/mo -54.4–113

Vapour deficit1,365 Pa 1,164–1,422

Wind speed2.50 m/s 2.30–2.70

Cloud cover31.1 % 25.1–32.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)