Apela neobule

Druce, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Apela

At a glance

Occurrence records273

Data sources5

Biological traits0

DNA specimens99

eDNA detections90

Sources5 archives

Databases and archives Apela neobule's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI90 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics99 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF273 records

Environmental DNA1 datasets · 1 countries90 detections

DNA & barcodingBOLD99 specimens

01Narrative

Apela neobule is een vlinder uit de familie van de tandvlinders (Notodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1905 door Druce.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding99 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apela neobule has left across the world's sequence archives.

At a glance

DNA specimens99

BINs1

Marker genes3

eDNA detections90

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

289Gmostly conserved

313Cmostly conserved

343Amostly conserved

370Gvariable

619Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes23

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apela lilacinasame genus3.7%Apela divisasame genus4.7%Apela leechisame genus6.6%Apela dubiosasame genus6.8%Apela senecauxisame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18SWnt1

animal barcoderibosomalmarker

08Occurrence & distribution

Record type273 records

Wild obs. + sensor5

Museum / vouchered268

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤1 km 1>10 km 4

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 268 records without

Open the institutions mapphysical evidence268

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	221
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	8
Tapachula, MX	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4

4 institutions · 237 of 268 vouchered records shown · 31 without an institution code

09Environmental DNA90 detections

Where the DNA of Apela neobule was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found90

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 90 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.0–25.3

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.8–30.1

Min temp (night)21.1 °C 20.2–22.8

Precipitation265 mm/mo 17.2–485

Air humidity69.1 % 59.3–75.5

Moisture balance125 mm/mo -139–349

Vapour deficit914 Pa 707–1,304

Wind speed2.00 m/s 1.00–5.60

Cloud cover31.3 % 13.5–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)