Apaustus gracilis

(C.Felder & R.Felder, 1867) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Apaustus

At a glance

Occurrence records94

Data sources6

Biological traits0

DNA specimens14

eDNA detections13

Sources6 archives

Databases and archives Apaustus gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

Apaustus gracilis is een vlinder uit de familie van de dikkopjes (Hesperiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1867 door Cajetan Freiherr von Felder & Felder.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apaustus gracilis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.38%

Haplotypes1

BINs2

Where individuals differ — all 16 variable positions, in barcode order

76Gmostly conserved

85Gmostly conserved

106Tmostly conserved

304Tmostly conserved

307Amostly conserved

367Tmostly conserved

400Cmostly conserved

490Cmostly conserved

499Tmostly conserved

508Amostly conserved

523Cmostly conserved

562Cmostly conserved

565Cmostly conserved

604Cmostly conserved

610Tmostly conserved

649Gmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTAATTATTCGTACAGAACTGGGTAACCCGGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polites origenessame family9.6%Polites mysticsame family9.7%Synapte malitiosasame family9.7%Joanna joannasame family9.9%Thespieus dalmansame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor72

Museum / vouchered22

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 21≤1 km 19≤10 km 8>10 km 5

53 georeferenced · 19 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 3≤10 km 9>10 km 1

13 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	13
National Biodiversity Institute, Costa Ricalocation not on record	4
Universidad Tecnológica del Chocó (UTCH)location not on record	2

3 institutions · 19 of 22 vouchered records shown · 3 without an institution code

09Environmental DNA13 detections

Where the DNA of Apaustus gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 21.4–25.5

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.6 °C 25.1–29.2

Min temp (night)21.2 °C 18.9–22.2

Precipitation182 mm/mo 37.3–403

Air humidity70.8 % 63.1–75.4

Moisture balance59.6 mm/mo -134–262

Vapour deficit817 Pa 666–1,204

Wind speed2.50 m/s 1.50–6.90

Cloud cover18.6 % 13.9–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)