Apatema baixerasi

Vives, 2001 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Autostichidae/Apatema

At a glance

Occurrence records3

Data sources6

Biological traits0

DNA specimens4

eDNA detections14

Sources6 archives

Databases and archives Apatema baixerasi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 4 countries14 detections

DNA & barcodingBOLD4 specimens

01Narrative

Apatema baixerasi is a moth of the family Autostichidae. It is found in Spain.Fauna Europaea

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apatema baixerasi has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.58%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 7 variable positions, in barcode order

92Cmostly conserved

280Cmostly conserved

355Cvariable

394Cmostly conserved

430Tmostly conserved

478Cvariable

595Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAATCGGAACATCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apatema acutivalvasame genus8.2%Apatema skuleisame genus9.7%Apatema transversumsame genus9.7%Apatema stadelisame genus10.2%Apatema lucidumsame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 records

Wild obs. + sensor1

Museum / vouchered2

Origin

Native1

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA14 detections

Where the DNA of Apatema baixerasi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 15.0–21.9

Seasonal swing summer↔winter13.5 °C

Max temp (day)22.6 °C 18.5–24.6

Min temp (night)13.9 °C 9.40–19.0

Precipitation56.4 mm/mo 11.8–90.1

Air humidity60.0 % 56.2–60.7

Moisture balance-5.90 mm/mo

Vapour deficit805 Pa 731–1,059

Wind speed3.30 m/s

Cloud cover39.8 % 33.4–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)