Apatania zonella

(Zetterstedt, 1840) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Apataniidae/Apatania

At a glance

Occurrence records1 579

Data sources7

Biological traits0

DNA specimens515

eDNA detections6

Sources7 archives

Databases and archives Apatania zonella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics515 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 579 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD515 specimens

01Narrative

Apatania zonella is a species of insect belonging to the family Apataniidae. It has almost cosmopolitan distribution.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding515 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apatania zonella has left across the world's sequence archives.

At a glance

DNA specimens515

BINs2

Marker genes3

eDNA detections6

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus497 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

40Amostly conserved

46Tmostly conserved

49Amostly conserved

160Tmostly conserved

202Gmostly conserved

217Cmostly conserved

232Tmostly conserved

313Cmostly conserved

325Gmostly conserved

343Gmostly conserved

367Amostly conserved

409Amostly conserved

574Amostly conserved

TATTTATTTTATTTTTGGAATTTGAGCCGGTATAGTCGGAACATCTCTAAGAATAATTATTCGAACTGAATTAGGAACAACTGAATCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes37

BINs2

Most divergent pair4.9%

N.AmericaEuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apatania forsslundisame genus1.5%Apatania auriculasame genus2.0%Apatania fimbriatasame genus4.0%Apatania stylatasame genus4.9%Apatania copiosasame genus6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type1 579 records

Wild obs. + sensor496

Museum / vouchered1 032

Fossil51

Range

Area of Occupancy AOO1 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 376≤1 km 41≤10 km 20>10 km 1

438 georeferenced · 58 without coordinates

Open the mapobservation + sensor496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 332≤1 km 22≤10 km 32>10 km 19

405 georeferenced · 627 without coordinates

Open the institutions mapphysical evidence1 032

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	296
Helsinki, FI	229
St. Paul, US	69
SLU Artdatabankenlocation not on record	44
Stockholm, SE	35
University of Guelph, Centre for Biodiversity Genomicslocation not on record	24
Toronto, CA	23
NHMOlocation not on record	12
Champaign, US	11
Montréal, CA	7
University of Alberta Museums (UAM)location not on record	6
Environment Canadalocation not on record	5
BioFokuslocation not on record	5
Colorado State Universitylocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Frankfurt am Main	2
Vancouver, CA	1
Zürich, CH	1
Rovaniemi, FI	1
Royal Ontario Museumlocation not on record	1
ZMAAlocation not on record	1

21 institutions · 778 of 1 032 vouchered records shown · 250 without an institution code

09Environmental DNA6 detections

Where the DNA of Apatania zonella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.50 °C 3.10–11.1

Seasonal swing summer↔winter13.6 °C

Max temp (day)9.40 °C 4.50–14.4

Min temp (night)2.80 °C -1.20–7.90

Precipitation87.1 mm/mo 83.7–101

Air humidity61.5 % 60.0–65.3

Moisture balance0.4 mm/mo -1.80–25.4

Vapour deficit397 Pa 288–531

Wind speed3.50 m/s 2.60–5.60

Cloud cover49.4 % 46.4–69.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apatania zonella

At a glance

Sources7 archives

At a glance

Record type1 579 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 579 records