Apanteles morrisi

Mason, 1974 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Apanteles

At a glance

Occurrence records70

Data sources6

Biological traits0

DNA specimens313

eDNA detections22

Sources6 archives

Databases and archives Apanteles morrisi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics313 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF70 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD313 specimens

01Narrative

Apanteles morrisi is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Mason in 1974.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding313 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apanteles morrisi has left across the world's sequence archives.

At a glance

DNA specimens313

BINs3

Marker genes5

eDNA detections22

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus228 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

30Tmostly conserved

48Tmostly conserved

51Amostly conserved

67Cmostly conserved

114Tmostly conserved

132Tmostly conserved

135Cmostly conserved

174Amostly conserved

180Amostly conserved

201Tmostly conserved

207Avariable

216Amostly conserved

222Amostly conserved

234Tmostly conserved

273Tmostly conserved

291Cmostly conserved

292Tmostly conserved

310Gmostly conserved

315Tmostly conserved

316Gmostly conserved

318Cvariable

321Tmostly conserved

378Cmostly conserved

387Amostly conserved

388Gmostly conserved

399Tmostly conserved

436Gmostly conserved

453Cvariable

529Amostly conserved

532Tmostly conserved

546Cmostly conserved

570Tmostly conserved

595Tvariable

600Cmostly conserved

645Tmostly conserved

ATTTTATATTTTTTATTTGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGACTAGAATTAGGAATACCAGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes35

BINs3

Most divergent pair11.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apanteles xanthostigmasame genus4.3%Apanteles franciscopizarroisame genus6.4%Apanteles brunnistigmasame genus6.9%Apanteles leneasame genus7.0%Apanteles subandinussame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS★ITS2CYTB28S-D2

animal barcodefungal barcodemitochondrialmarker

08Occurrence & distribution

Record type70 records

Museum / vouchered70

Range

Area of Occupancy AOO60 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence70

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montréal, CA	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Canadian Forest Service, Atlantic Forestry Centrelocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

4 institutions · 10 of 70 vouchered records shown · 60 without an institution code

09Environmental DNA22 detections

Where the DNA of Apanteles morrisi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

Temperate mixed forestMixed habitat1. Forest & WoodlandForestedge of deciduous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 15.0–20.4

Seasonal swing summer↔winter30.3 °C

Max temp (day)23.5 °C 19.6–25.2

Min temp (night)13.4 °C 10.2–16.3

Precipitation84.1 mm/mo 76.4–108

Air humidity59.3 % 57.6–60.7

Moisture balance-47.6 mm/mo -66.0–-0.4

Vapour deficit858 Pa 691–966

Wind speed2.70 m/s 2.30–3.50

Cloud cover43.3 % 41.1–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)