Apanteles galleriae

Wilkinson, 1932 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Apanteles

At a glance

Occurrence records178

Data sources6

Biological traits0

DNA specimens32

eDNA detections29

Sources6 archives

Databases and archives Apanteles galleriae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility178 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF178 records

Environmental DNA1 datasets · 10 countries29 detections

DNA & barcodingBOLD32 specimens

01Narrative

Apanteles galleriae is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Wilkinson in 1932.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apanteles galleriae has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes1

eDNA detections29

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

23Tvariable

28Amostly conserved

181Amostly conserved

299Gmostly conserved

337Tvariable

466Gvariable

586Tvariable

631Tmostly conserved

634Cmostly conserved

635Cmostly conserved

637Amostly conserved

639Tmostly conserved

641Tmostly conserved

643Amostly conserved

646Tmostly conserved

653Tmostly conserved

654Tmostly conserved

658Tmostly conserved

TATTTTATATTTCATATTTGGATTATGAGCCGGTATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes4

BIN1

Most divergent pair3.2%

N.AmericaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apanteles milenagutierrezaesame genus9.0%Apanteles ronaldcastroisame genus9.9%Apanteles erickduarteisame genus9.9%Apanteles adrianaguilaraesame genus10.0%Apanteles subandinussame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type178 records

Wild obs. + sensor4

Museum / vouchered174

Origin

Introduced15

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 148

148 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	137
MWLRlocation not on record	15
Auckland, NZ	12
New Zealand Arthropod Collectionlocation not on record	3
UVEG-ENVlocation not on record	2
CUlocation not on record	1
Landcare Research, New Zealand Arthropod Collectionlocation not on record	1

7 institutions · 171 of 174 vouchered records shown · 3 without an institution code

09Environmental DNA29 detections

Where the DNA of Apanteles galleriae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map10 countries0

1. Forest & Woodland1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.9. Subtropical/Tropic…Urban GardenAgricultural arable field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 14.4–26.2

Seasonal swing summer↔winter6.60 °C

Max temp (day)25.6 °C 15.9–30.3

Min temp (night)16.6 °C 12.0–22.2

Precipitation109 mm/mo 56.0–430

Air humidity62.4 % 54.5–65.0

Moisture balance-15.4 mm/mo -65.4–280

Vapour deficit971 Pa 634–1,361

Wind speed1.80 m/s 1.10–3.30

Cloud cover34.0 % 16.1–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)