Apanteles carpatus

(Say, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Apanteles

At a glance

Occurrence records131

Data sources6

Biological traits0

DNA specimens115

eDNA detections89

Sources6 archives

Databases and archives Apanteles carpatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF131 records

Environmental DNA3 datasets · 11 countries89 detections

DNA & barcodingBOLD115 specimens

01Narrative

Apanteles carpatus is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Say in 1836.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apanteles carpatus has left across the world's sequence archives.

At a glance

DNA specimens115

BINs2

Marker genes5

eDNA detections89

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 74% of positions are identical in every specimen.

Where individuals differ — all 174 variable positions, in barcode order

13Cmostly conserved

14Cmostly conserved

22Amostly conserved

23Amostly conserved

55Amostly conserved

67Amostly conserved

76Amostly conserved

83Cmostly conserved

88Amostly conserved

91Amostly conserved

100Amostly conserved

106Cmostly conserved

124Cmostly conserved

125Amostly conserved

133Amostly conserved

157Cmostly conserved

169Amostly conserved

172Amostly conserved

181Avariable

184Amostly conserved

205Amostly conserved

220Amostly conserved

235Cmostly conserved

247Cmostly conserved

256Amostly conserved

259Cmostly conserved

263Tmostly conserved

265Amostly conserved

268Amostly conserved

274Tmostly conserved

277Amostly conserved

298Amostly conserved

299Amostly conserved

300Gvariable

311Amostly conserved

312Cmostly conserved

316Amostly conserved

319Amostly conserved

325Cmostly conserved

364Cmostly conserved

373Amostly conserved

382Amostly conserved

391Amostly conserved

400Cmostly conserved

401Cmostly conserved

409Tmostly conserved

412Amostly conserved

415Amostly conserved

418Amostly conserved

421Amostly conserved

424Tmostly conserved

436Amostly conserved

439Amostly conserved

454Amostly conserved

470Amostly conserved

474Amostly conserved

476Tmostly conserved

477Tmostly conserved

478Amostly conserved

481Tmostly conserved

482Amostly conserved

484Tmostly conserved

487Amostly conserved

488Gmostly conserved

489Amostly conserved

490Tmostly conserved

491Amostly conserved

493Amostly conserved

495Tmostly conserved

497Tmostly conserved

498Cmostly conserved

499Amostly conserved

501Tmostly conserved

505Tmostly conserved

506Avariable

507Tmostly conserved

509Tmostly conserved

510Gmostly conserved

511Amostly conserved

513Cmostly conserved

515Gmostly conserved

516Tmostly conserved

517Amostly conserved

518Tmostly conserved

520Tmostly conserved

521Amostly conserved

525Cmostly conserved

526Avariable

527Gmostly conserved

529Tvariable

530Amostly conserved

531Tmostly conserved

533Cvariable

535Cvariable

536Tmostly conserved

538Amostly conserved

546Cmostly conserved

547Amostly conserved

549Tmostly conserved

551Cmostly conserved

552Cmostly conserved

553Cvariable

554Gmostly conserved

555Tmostly conserved

556Amostly conserved

557Tmostly conserved

559Amostly conserved

560Gmostly conserved

561Cmostly conserved

562Amostly conserved

564Gmostly conserved

565Tmostly conserved

567Cmostly conserved

568Tmostly conserved

569Amostly conserved

570Tmostly conserved

573Cmostly conserved

574Avariable

576Tmostly conserved

578Tmostly conserved

+54 more variable positions not shown

TATATTATATTTCCTATTTGGAATATGATCTGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGTATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.8%

Haplotypes4

BINs2

Most divergent pair0.61%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apanteles albanjimenezisame genus7.9%Apanteles juniorlopezisame genus8.4%Apanteles felixcarmonaisame genus9.0%Apanteles zeneidabolanosaesame genus9.1%Apanteles laurenmoralesaesame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITSCYTB28S-D2Wnt1

animal barcodefungal barcodemitochondrialmarker

08Occurrence & distribution

Record type131 records

Wild obs. + sensor11

Museum / vouchered105

Other15

Origin

Introduced15

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 8≤1 km 1>10 km 1

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 1≤1 km 9≤10 km 9

19 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	15
Champaign, US	15
Honolulu, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
New Zealand Arthropod Collectionlocation not on record	6
South Kensington, GB	4
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	4
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
UVEG-ENVlocation not on record	2
Landcare Research, New Zealand Arthropod Collectionlocation not on record	2
Helsinki, FI	2
CUlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

14 institutions · 72 of 105 vouchered records shown · 33 without an institution code

09Environmental DNA89 detections

Where the DNA of Apanteles carpatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys3

Countries11

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map11 countries0

14. Artificial - Terrestrial|14.1 Arable Land8. Desert | 8.1. Hot DesertfarmUrban GardenMentha pulegiumUrban meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 11.2–20.9

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.6 °C 16.0–26.1

Min temp (night)12.5 °C 6.10–16.2

Precipitation92.5 mm/mo 56.5–109

Air humidity59.3 % 56.6–61.2

Moisture balance-40.8 mm/mo -69.7–13.1

Vapour deficit758 Pa 563–1,031

Wind speed3.30 m/s 2.30–4.40

Cloud cover43.4 % 35.3–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)