Apamea burgessi

Morrison, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records340

Data sources7

Biological traits0

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Apamea burgessi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility340 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF340 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Apamea burgessi is a moth of the family Noctuidae. It is native to central North America, where it can be found throughout the Great Plains and Great Basin. Its distribution extends north to Alberta and south to Texas. There is a disjunct population on the East Coast of the United States.Apamea burgessi. Pacific Northwest Moths. The wingspan is 38–40 mm. The forewing is streaked tan and gray and the hindwing is white. The flight season is in September and October.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea burgessi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

7Amostly conserved

31Avariable

37Avariable

40Gvariable

46Cvariable

79Amostly conserved

82Tvariable

85Tmostly conserved

94Amostly conserved

115Tmostly conserved

121Cvariable

202Avariable

214Amostly conserved

217Avariable

235Cvariable

262Amostly conserved

265Avariable

277Tmostly conserved

280Avariable

287Tvariable

312Amostly conserved

316Amostly conserved

340Tvariable

346Cvariable

349Tvariable

361Cmostly conserved

367Cvariable

379Amostly conserved

382Avariable

400Cmostly conserved

406Tmostly conserved

421Cmostly conserved

427Tmostly conserved

433Amostly conserved

469Amostly conserved

484Cvariable

526Tvariable

547Tmostly conserved

601Cvariable

616Tmostly conserved

625Avariable

628Gvariable

634Tvariable

640Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes5

BINs3

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea ferragosame genus4.0%Apamea rubrirenasame genus4.1%Arenostola unicolorsame family4.3%Ulochlaena hirtasame family4.3%Apamea dubitanssame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type340 records

Wild obs. + sensor63

Museum / vouchered277

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 24≤1 km 7≤10 km 18>10 km 5

54 georeferenced · 9 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 41≤1 km 38≤10 km 106>10 km 22

207 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
King Saud Universitylocation not on record	103
Colorado State Universitylocation not on record	57
New Haven, US	36
University of Alberta Museums (UAM)location not on record	17
US	12
Mississippi State, US	11
East Lansing, US	9
St. Paul, US	8
Vernal, US	4
Washington, US	4
UDlocation not on record	3
WWUlocation not on record	2
Decorah, US	1
ZSMlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

15 institutions · 269 of 277 vouchered records shown · 8 without an institution code

09Environmental DNA13 detections

Where the DNA of Apamea burgessi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 11.3–20.1

Seasonal swing summer↔winter25.2 °C

Max temp (day)21.8 °C 18.1–27.4

Min temp (night)9.60 °C 4.60–14.8

Precipitation38.3 mm/mo 10.3–80.7

Air humidity49.3 % 43.1–55.8

Moisture balance-77.4 mm/mo -98.1–-23.3

Vapour deficit798 Pa 660–1,347

Wind speed3.70 m/s 2.30–4.70

Cloud cover31.7 % 25.8–34.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)