Apamea atrosuffusa

Barnes & McDunnough, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records340

Data sources7

Biological traits0

DNA specimens9

eDNA detections9

Sources7 archives

Databases and archives Apamea atrosuffusa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility340 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF340 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Apamea atrosuffusa is a species of cutworm or dart moth in the family Noctuidae first described by William Barnes and James Halliday McDunnough in 1913. It is found in North America. The MONA or Hodges number for Apamea atrosuffusa is 9336.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea atrosuffusa has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

466Gmostly conserved

606Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTGTTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrospila succineasame family3.8%Apamea altijugasame genus4.0%Apamea kuusamoensissame genus4.1%Apamea dubitanssame genus4.1%Apamea longulasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type340 records

Wild obs. + sensor36

Museum / vouchered304

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 4≤1 km 5≤10 km 21>10 km 2

32 georeferenced · 4 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 68≤1 km 52≤10 km 148>10 km 12

280 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence304

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	145
New Haven, US	87
US	20
Denver, US	18
East Lansing, US	11
Mississippi State, US	9
Albuquerque, US	9
ASUlocation not on record	2
Champaign, US	1
München, DE	1
University of California, Davislocation not on record	1

11 institutions · 304 of 304 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Apamea atrosuffusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 7.30–17.7

Seasonal swing summer↔winter22.4 °C

Max temp (day)23.5 °C 14.3–24.5

Min temp (night)10.4 °C 0.8–12.3

Precipitation71.0 mm/mo 41.3–119

Air humidity51.7 % 49.0–53.8

Moisture balance-44.4 mm/mo -99.8–-14.9

Vapour deficit936 Pa 486–997

Wind speed2.30 m/s 2.00–3.10

Cloud cover25.4 % 18.9–32.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)