Apamea amputatrix

Fitch, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records3 563

Data sources7

Biological traits0

DNA specimens188

eDNA detections187

Sources7 archives

Databases and archives Apamea amputatrix's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 563 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI187 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics188 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 563 records

Environmental DNA1 datasets · 2 countries187 detections

DNA & barcodingBOLD188 specimens

01Narrative

Apamea amputatrix, the yellow-headed cutworm, is a moth of the family Noctuidae. It is found in most of North America, north to the Arctic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding188 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea amputatrix has left across the world's sequence archives.

At a glance

DNA specimens188

BINs1

Marker genes1

eDNA detections187

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus182 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

364Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes21

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea contradictasame genus4.0%Apamea kuusamoensissame genus4.3%Apamea dubitanssame genus4.3%Apamea maillardisame genus4.4%Apamea atriclavasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 563 records

Wild obs. + sensor1 999

Museum / vouchered1 564

Range

Area of Occupancy AOO6 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 201≤1 km 220≤10 km 101>10 km 120

1 642 georeferenced · 357 without coordinates

Open the mapobservation + sensor1 999

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 197≤1 km 127≤10 km 421>10 km 55

800 georeferenced · 764 without coordinates

Open the institutions mapphysical evidence1 564

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	271
New Haven, US	237
Oregon State Arthropod Collectionlocation not on record	197
East Lansing, US	174
University of Alberta Museums (UAM)location not on record	78
Cleveland Museum of Natural History, OH (CLEV)location not on record	74
Vernal, US	70
St. Paul, US	61
University of Guelph, Centre for Biodiversity Genomicslocation not on record	61
Denver, US	26
WWUlocation not on record	21
Royal Saskatchewan Museumlocation not on record	21
Mississippi State, US	17
Cambridge, US	15
ASUlocation not on record	14
Philadelphia, US	11
San Diego, US	10
US	10
OSUClocation not on record	9
Toronto, CA	9
Awka, NG	8
Brussels, BE	8
Essig Museum of Entomologylocation not on record	6
SOVTlocation not on record	5
University of California, Davislocation not on record	5
Cornell University Insect Collectionlocation not on record	4
National Institute of Biological Resourceslocation not on record	3
Georgia Museum of Natural Historylocation not on record	3
RBINS-Scientific Heritagelocation not on record	2
Albuquerque, US	2
UDlocation not on record	2
Washington, US	1
King Saud Universitylocation not on record	1
University of Guelphlocation not on record	1
San Francisco, US	1

35 institutions · 1 438 of 1 564 vouchered records shown · 126 without an institution code

09Environmental DNA187 detections

Where the DNA of Apamea amputatrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found187

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 187 detections have coordinates

Open the map2 countries0

Riparian ZoneTemperate mixed forest1. Forest & Woodland8. Desert | 8.1. Hot Desert14. Artificial - Terrestrial|14.1 Arable LandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 14.3–19.8

Seasonal swing summer↔winter23.2 °C

Max temp (day)22.9 °C 18.7–25.2

Min temp (night)12.5 °C 9.80–16.0

Precipitation67.6 mm/mo 18.5–110

Air humidity59.1 % 52.1–64.3

Moisture balance-63.6 mm/mo -123–0.7

Vapour deficit833 Pa 644–1,016

Wind speed2.90 m/s 1.90–4.20

Cloud cover33.4 % 27.5–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 185 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apamea amputatrix

At a glance

Sources7 archives

At a glance

Record type3 563 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 563 records