Apalis flavida

(Strickland, 1853) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Cisticolidae/Apalis

At a glance

Occurrence records89 252

Data sources8

Biological traits26

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Apalis flavida's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 252 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF89 252 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

The yellow-breasted apalis (Apalis flavida) is a species of bird in the family Cisticolidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth2.6 mm

Beak length (culmen)13.6 mm

Beak length (nares)7.6 mm

Beak width2.8 mm

Body mass8.18 g

Body mass (female)7.97 g

Body mass (male)8.5 g

Hand-wing index9.1

Kipp's distance4.5 mm

Secondary length45.1 mm

Tail length49 mm

Tarsus length18.9 mm

Wing length49.6 mm

Life cycle & reproduction2

Egg mass0.92 g

Litter size2.65

Diet & foraging7

Canopy80 %

Fruit10 %

Invertebrate80 %

Midhigh20 %

Nectar10 %

Trophic levelcarnivore

Trophic nicheInvertivore

Habitat & environment4

HabitatWoodland

Migration1.0

Primary lifestyleInsessorial

Range size4 880 471 km²

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apalis flavida has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P666 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

2Gmostly conserved

3Cmostly conserved

4Gmostly conserved

5Cmostly conserved

6Amostly conserved

7Tmostly conserved

9Amostly conserved

10Gmostly conserved

12Cmostly conserved

14Gmostly conserved

35Tmostly conserved

38Cmostly conserved

44Tmostly conserved

53Amostly conserved

119Cmostly conserved

200Cmostly conserved

248Cmostly conserved

260Cmostly conserved

266Gmostly conserved

284Tmostly conserved

344Cmostly conserved

353Gmostly conserved

359Tmostly conserved

383Cmostly conserved

392Tmostly conserved

396Amostly conserved

467Gmostly conserved

491Amostly conserved

503Tmostly conserved

513Cmostly conserved

516Cmostly conserved

530Amostly conserved

533Tmostly conserved

566Tmostly conserved

587Cmostly conserved

596Cmostly conserved

605Amostly conserved

614Tmostly conserved

647Tmostly conserved

650Tmostly conserved

662Tmostly conserved

GGCGCATGAGCCGGATAGTAGGCACTTCACTCAGTCTCCTCATTCGAGCAGAACTGGGCCAACCAGGCGCCCTTCTAGGAGATGACCAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes3

BINs2

Most divergent pair6.2%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apalis thoracicasame genus11.7%Prinia inornatasame family11.8%Prinia subflavasame family12.0%Camaroptera brachyurasame family12.1%Orthotomus sericeussame family12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type89 252 records

Wild obs. + sensor89 032

Museum / vouchered102

Cultivated / captive1

Other117

Origin

Native37

Range

Area of Occupancy AOO40 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 136≤1 km 309≤10 km 106>10 km 72

1 623 georeferenced · 87 409 without coordinates

Open the mapobservation + sensor89 032

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤1 km 5≤10 km 22>10 km 4

31 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence102

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CPMMlocation not on record	33
Los Angeles, US	17
Cambridge, US	14
New Haven, US	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	6
Seattle, US	5
Ann Arbor, US	5
Chongqing Museumlocation not on record	4
CEFElocation not on record	3
Texas Cooperative Wildlife Collectionlocation not on record	3
Denver, US	2
Paris, FR	2

12 institutions · 102 of 102 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Apalis flavida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Afromontane forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 12.3–19.6

Seasonal swing summer↔winter8.80 °C

Max temp (day)22.0 °C 19.0–25.9

Min temp (night)8.70 °C 6.40–13.7

Precipitation21.1 mm/mo 21.1–72.9

Air humidity54.0 % 51.5–59.2

Moisture balance-41.7 mm/mo -61.2–-33.4

Vapour deficit774 Pa 693–930

Wind speed2.00 m/s 1.90–2.50

Cloud cover9.90 % 7.30–22.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apalis flavida

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging7

Habitat & environment4

At a glance

Record type89 252 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type89 252 records