Aotus ericoides

(Vent.) G.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Aotus

At a glance

Occurrence records9 000

Data sources10

Biological traits44

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Aotus ericoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 000 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF9 000 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Aotus ericoides, also known as common aotus or golden pea, is a shrub in the family Fabaceae. It flowers in leaf axils in spring and has yellow pea flowers with splotches of red. It is endemic to eastern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length6.5 mm

Leaf length20 mm

Leaf length max20 mm

Leaf length min6 mm

Leaf mass per area145 g/m2

Leaf size18.4 mm²

Leaf width4 mm

Leaf width max5 mm

Leaf width min1 mm

Petiole length0.15 cm

Plant height2 m

⚠ sources differ — AusTraits: 2 m · TRY: 1.83 m

Plant height max2 m

Seed length2.5 mm

Seed mass3.1 mg

⚠ sources differ — TRY: 3.1 mg · AusTraits: 2.75 mg · GIFT: 2.79 mg

Seed mass max5.1 mg

Seed mass min1.6 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering timennnnnnnyyyyn

Life formshrub

Life spanperennial

Lifespan years60 years

⚠ sources differ — TRY: 60 years · AusTraits: 42.5 years

Pollination syndromeinsect

Reproductive maturity4 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate linear ovate

Woodinesswoody

Physiology & chemistry6

Leaf c531 mg/g

Leaf n14.74 mg/g

Leaf p0.388 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.16 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aotus ericoides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594132.1 ↗612 bpAustralia · 2017

ACGT

AACGACATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGGTTCAAAGCTGGTGTTAAAGATTATAGATTGACTTATTATACTCCTGAC …

Aotus ericoides voucher 600300313 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Aotus ericoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

n 82×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.968 ↗

08Occurrence & distribution

Record type9 000 records

Wild obs. + sensor7 446

Museum / vouchered1 492

Cultivated / captive10

Other52

Origin

Native308

Range

Area of Occupancy AOO13 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 5 496≤1 km 1 166≤10 km 396>10 km 48

7 106 georeferenced · 340 without coordinates

Open the mapobservation + sensor7 446

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 140≤1 km 461≤10 km 575>10 km 108

1 284 georeferenced · 208 without coordinates

Open the institutions mapphysical evidence1 492

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy89% within 1 km

≤100 m 6≤1 km 2≤10 km 1

9 georeferenced · 1 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	304
Canberra, AU	291
Hobart, AU	271
Museo Entomologico de Leonlocation not on record	256
Brisbane, AU	97
QVMAGlocation not on record	81
Adelaide, AU	48
Armidale, AU	42
Wollongong, AU	26
Batemans Bay, AU	14
NSW Dept of Planning, Industry and Environmentlocation not on record	11
Parkville, AU	9
Smithfield, AU	5
Saint Louis, US	4
La Trobe Universitylocation not on record	3
John T. Waterhouse Herbariumlocation not on record	3
Palmerston, AU	3
Universität Tübingenlocation not on record	3
Stockholm, SE	2
Kew, GB	2
Kensington, AU	2
Auckland, NZ	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
AUAlocation not on record	1
LDlocation not on record	1
MeiseBGlocation not on record	1
Claremont, US	1
GB	1
MAlocation not on record	1
Wellington, NZ	1
Cambridge University Herbariumlocation not on record	1

31 institutions · 1 488 of 1 492 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Aotus ericoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter8.90 °C

Max temp (day)20.2 °C

Min temp (night)13.8 °C

Precipitation70.5 mm/mo

Air humidity54.8 %

Moisture balance-54.8 mm/mo

Vapour deficit866 Pa

Wind speed4.80 m/s

Cloud cover24.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aotus ericoides

At a glance

Sources10 archives

Size & morphology16

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type9 000 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 000 records