Aora gracilis

(Spence Bate, 1857) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Aoridae/Aora

At a glance

Occurrence records4 294

Data sources7

Biological traits4

DNA specimens32

eDNA detections53

Sources7 archives

Databases and archives Aora gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 208 records↗

OBISOcean Biodiversity Information System2 086 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS4 294 records

Environmental DNA4 datasets · 7 countries53 detections

DNA & barcodingBOLD32 specimens

01Narrative

Aora gracilis is een euryhalien vlokreeftje uit de familie Aoridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1857 door Bate.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max32 m

Depth min28 m

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aora gracilis has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes3

eDNA detections53

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

190Avariable

212Tmostly conserved

286Amostly conserved

313Gvariable

340Cmostly conserved

343Tvariable

373Gvariable

394Tmostly conserved

436Amostly conserved

469Avariable

539Tmostly conserved

601Tmostly conserved

621Tmostly conserved

646Cmostly conserved

TACTTTATATTTCATTTTAGGTTTTTGATCCGGTTTAGCAGGAACCTCCCTTAGTTTAATTATCCGTACAGAGCTAAGGGCCCCCGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes16

BIN1

Most divergent pair2.0%

OtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aoroides longimerussame family16.0%Aoroides columbiaesame family16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P18S-V4

animal barcoderibosomal

08Occurrence & distribution

Record type4 294 records

Wild obs. + sensor1 115

Museum / vouchered2 236

Other943

Range

Area of Occupancy AOO4 504 km²

Depth

0–200 m sunlit852

200–1000 m twilight8

1–4 km midnight0

>4 km abyssal0

median 15.9 m · max 362.3 m · 860 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 782≤1 km 39≤10 km 19

840 georeferenced · 275 without coordinates

Open the mapobservation + sensor1 115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 188≤1 km 91≤10 km 4

283 georeferenced · 1 953 without coordinates

Open the institutions mapphysical evidence2 236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	385
Institut Francais pour l'Etude de la Merlocation not on record	77
DASSHlocation not on record	76
486location not on record	65
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	61
Station Biologique de Roscoff (EDMO:521)location not on record	47
RWSlocation not on record	44
Citadel Hill, GB	34
730location not on record	24
Bergen, NO	19
ARMS-MBONlocation not on record	14
Laboratoire d'Océanographie Biologique, Universite de Bordeaxlocation not on record	13
PNHSlocation not on record	9
South Kensington, GB	7
Norwegian Institute of Marine Researchlocation not on record	6
Gothenburg, SE	5
Natural History Museum of the Iberian Peninsula - NatMIP ("Museu de História Natural da Península Ibérica")location not on record	4
NTNU-VMlocation not on record	3
Biomorlocation not on record	3
Brussels, BE	3
SLU Artdatabankenlocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
University of Oslo (UiO)location not on record	2
Tromsø, NO	2
AUTHlocation not on record	2
Goteborg Natural History Museumlocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Université de Liège Underwater research and oceanographic station (4501)location not on record	1
WoRMS Editorial Boardlocation not on record	1
Auckland, NZ	1

30 institutions · 915 of 2 236 vouchered records shown · 53 without an institution code

09Environmental DNA53 detections

Where the DNA of Aora gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys4

Countries7

Verifiable raw sequence linked23

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map7 countries0

Industrial port; industrial; 9.4 - Subtidal …Industrial port; industrial; 9.5 - Subtidal …Marina; semi-industrial; 9.2 - Subtidal Rock…Ship fouling faunaIndustrial port; industrial; 9.2 - Subtidal …Marina; semi-industrial; 9.5 - Subtidal Sand…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 6.40–16.2

Seasonal swing summer↔winter14.2 °C

Max temp (day)14.4 °C 9.00–18.1

Min temp (night)11.2 °C 4.00–14.5

Precipitation82.3 mm/mo 49.7–120

Air humidity64.4 % 62.1–65.2

Vapour deficit476 Pa 374–701

Cloud cover51.7 % 42.8–65.4

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aora gracilis

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type4 294 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 294 records