Aoplonema princeps

(Uhler, 1894) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Aoplonema

At a glance

Occurrence records395

Data sources5

Biological traits0

DNA specimens97

eDNA detections98

Sources5 archives

Databases and archives Aoplonema princeps's data was compiled from.

GBIFGlobal Biodiversity Information Facility395 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI98 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF395 records

Environmental DNA1 datasets · 2 countries98 detections

DNA & barcodingBOLD97 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aoplonema princeps has left across the world's sequence archives.

At a glance

DNA specimens97

BINs1

Marker genes1

eDNA detections98

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus96 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

1Cmostly conserved

2Tvariable

68Cmostly conserved

77Cvariable

83Tmostly conserved

113Cvariable

131Cmostly conserved

197Cvariable

200Amostly conserved

209Gmostly conserved

215Gmostly conserved

282Cvariable

291Cmostly conserved

314Gmostly conserved

338Tvariable

341Gvariable

353Gvariable

377Tvariable

399Tmostly conserved

404Cvariable

413Amostly conserved

414Gmostly conserved

434Tmostly conserved

440Tmostly conserved

476Amostly conserved

548Avariable

563Gvariable

605Gvariable

617Amostly conserved

623Amostly conserved

626Avariable

629Amostly conserved

647Avariable

651Cvariable

CTCTATATTTTATATTTGGAATATGAGCCGGAATATTAGGGACTTCTTTAAGATGAATCATTCGTATCGAATTAGGCATACCTGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes35

BIN1

Most divergent pair7.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Brachynotocoris puncticornissame family13.8%Dichaetocoris piceicolasame family15.0%Orthotylus obscurussame family15.3%Slaterocoris atritibialissame family15.6%Heterotoma planicornissame family15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type395 records

Wild obs. + sensor14

Museum / vouchered381

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 9>10 km 2

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 381 records without

Open the institutions mapphysical evidence381

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	364
San Francisco, US	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2

3 institutions · 377 of 381 vouchered records shown · 4 without an institution code

09Environmental DNA98 detections

Where the DNA of Aoplonema princeps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found98

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 98 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest8. Desert | 8.1. Hot Desert4. Native GrasslandChaparral hills4. Native Grassland | 4.4. Temperate GrasslandUpper Grassland, Mid-Seral

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 16.0–21.2

Seasonal swing summer↔winter19.7 °C

Max temp (day)27.2 °C 23.2–29.5

Min temp (night)12.0 °C 9.00–14.2

Precipitation6.40 mm/mo 2.50–39.3

Air humidity46.9 % 37.5–52.8

Moisture balance-158 mm/mo -190–-122

Vapour deficit1,161 Pa 928–1,470

Wind speed3.90 m/s 2.20–6.50

Cloud cover29.5 % 19.1–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 98 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)