Aonidiella orientalis

(Newstead, 1894) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Diaspididae/Aonidiella

At a glance

Occurrence records37

Data sources9

Biological traits0

DNA specimens11

eDNA detections1

Sources9 archives

Databases and archives Aonidiella orientalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · TreeOfSex2n = 8

01Narrative

Aonidiella orientalis is a species of insect in the family Diaspididae, the armored scale insects. It is known commonly as the Oriental yellow scale.Aonidiella orientalis (Oriental yellow scale). Invasive Species Compendium. CABI. It is an agricultural pest on a wide variety of crop plants.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aonidiella orientalis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P540 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TAGAATAGTAACAATCCATGCTCTAATAATAATTTTTTTCATAACAATACCTATTATTATTGGAAGAATAAGAAATTGATTAATTCCAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aonidiella pinisame genus7.0%Aonidiella ensiferasame genus10.9%Hemiberlesia pitysophilasame family10.9%Chrysomphalus aonidumsame family12.2%Hemiberlesia rapaxsame family12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aonidiella orientalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 82×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type37 records

Wild obs. + sensor17

Museum / vouchered20

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 4>10 km 12

17 georeferenced

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	9
Universidad Nacional de Colombia (UNAL)location not on record	3
Washington, US	1

3 institutions · 13 of 20 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Aonidiella orientalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter3.50 °C

Max temp (day)28.0 °C

Min temp (night)20.7 °C

Precipitation183 mm/mo

Air humidity66.7 %

Moisture balance23.4 mm/mo

Vapour deficit998 Pa

Wind speed2.00 m/s

Cloud cover27.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)