Aonidiella citrina

(Coquillett, 1891) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Diaspididae/Aonidiella

At a glance

Occurrence records57

Data sources9

Biological traits0

DNA specimens14

eDNA detections6

Sources9 archives

Databases and archives Aonidiella citrina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · TreeOfSex2n = 8

01Narrative

Aonidiella citrina or yellow scale is an armored scale insect from the family Diaspididae. It feeds by sucking sap from plants in a number of plant families, but is mostly known for being a pest of citrus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aonidiella citrina has left across the world's sequence archives.

At a glance

DNA specimens14

BINs4

Marker genes2

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P510 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

18Amostly conserved

30Avariable

57Avariable

84Tvariable

88Tvariable

93Cvariable

96Avariable

111Avariable

114Gvariable

127Cmostly conserved

135Avariable

150Cvariable

162Tvariable

172Tvariable

180Gvariable

186Cvariable

204Cvariable

213Tvariable

234Amostly conserved

285Avariable

288Cvariable

300Tvariable

330Tvariable

344Avariable

345Tvariable

382Tvariable

396Tvariable

399Tvariable

423Tvariable

424Cvariable

426Cvariable

435Tvariable

439Tvariable

441Avariable

453Cvariable

463Cvariable

480Cvariable

492Tvariable

501Cvariable

TCATATTATAGAACAGTAACAATTCATGCATTAATAATAATTTTTTTTATAACAATACCAATTATTATTGGAAGAATAAGAAATTGATTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes3

BINs4

Most divergent pair7.1%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysomphalus bifasciculatussame family5.9%Aonidiella inornatasame genus8.2%Chrysomphalus aonidumsame family9.0%Aonidiella ensiferasame genus9.4%Aonidiella pinisame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aonidiella citrina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 82×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type57 records

Wild obs. + sensor1

Museum / vouchered56

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 56 records without

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	33
Washington, US	1

2 institutions · 34 of 56 vouchered records shown · 21 without an institution code

09Environmental DNA6 detections

Where the DNA of Aonidiella citrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 22.4–25.0

Seasonal swing summer↔winter24.2 °C

Max temp (day)29.2 °C 28.0–30.4

Min temp (night)15.6 °C 14.2–17.0

Precipitation9.30 mm/mo 6.30–12.3

Air humidity38.2 % 36.9–39.5

Moisture balance-153 mm/mo -176–-130

Vapour deficit2,134 Pa 1,979–2,290

Wind speed3.70 m/s 2.70–4.70

Cloud cover16.9 % 13.1–20.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)