Aonidiella aurantii

(Maskell, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Diaspididae/Aonidiella

At a glance

Occurrence records570

Data sources9

Biological traits0

DNA specimens73

eDNA detections84

Sources9 archives

Databases and archives Aonidiella aurantii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility570 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI84 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS168 compounds

Occurrence & distributionGBIF570 records

Environmental DNA2 datasets · 7 countries84 detections

DNA & barcodingBOLD73 specimens

Genome at a glanceGoaT · TreeOfSex2n = 8

01Narrative

Aonidiella aurantii or red scale is an armored scale insect and a major pest of citrus. It is thought to be a native of South ChinaLongo, S., Marotta, S., Pellizzari, G., Russo, A. and A. Tranfaglia, 1995. "An annotated list of the scale insects (Homoptera: Coccoidea) of Italy". Israel Journal of Entomology 29: 113–130. but has been widely dispersed by the agency of man through the movement of infected plant material. In the United States it is known as California red scale. It was first found in California between 1868 and 1875, apparently brought there on planting material imported from Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition168 compounds

Compounds documented for Aonidiella aurantii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Neolignans10

Phenylethanoids7

Labdane diterpenoids $ Norlabdane diterpenoids7

Cyclic peptides $ Depsipeptides6

Monocyclic monoterpenoids6

Documented compounds168 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-3-Carene	present	NPASS
(+)-alpha-Carene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-beta-Phellandrene	present	NPASS
(+)-Pinoresinol	present	NPASS
(+)-taxifolin	present	NPASS
(-)-alpha-Pinene	present	NPASS
(-)-beta-Phellandrene	present	NPASS
(-)-beta-Pinene	present	NPASS
(-)-Catechol	present	NPASS

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aonidiella aurantii has left across the world's sequence archives.

At a glance

DNA specimens73

BINs4

Marker genes2

eDNA detections84

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.7%

Haplotypes2

BINs3

Most divergent pair0.31%

Where individuals differ — all 36 variable positions, in barcode order

103Cvariable

104Tmostly conserved

139Avariable

151Tvariable

223Gvariable

232Tvariable

235Cvariable

259Cvariable

271Tvariable

289Gvariable

295Cvariable

313Cvariable

325Tvariable

328Avariable

347Tvariable

397Cvariable

419Tvariable

436Tvariable

454Tvariable

523Avariable

533Cvariable

535Cvariable

544Tvariable

548Tvariable

550Avariable

562Cvariable

572Cvariable

589Cvariable

601Tvariable

607Tvariable

616Amostly conserved

622Gvariable

625Cmostly conserved

631Cmostly conserved

637Cmostly conserved

649Tvariable

ATTCATATATTTAATATTAGGAATTTGATCAGGAATAATAGGAATATCAATAAGAATAATTATTCGAACTGAATTAATTAATATTAATAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysomphalus bifasciculatussame family6.2%Hemiberlesia rapaxsame family8.6%Aonidiella inornatasame genus8.7%Aonidiella ensiferasame genus9.2%Chrysomphalus aonidumsame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aonidiella aurantii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 82×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type570 records

Wild obs. + sensor260

Museum / vouchered310

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 66≤1 km 11≤10 km 14>10 km 41

132 georeferenced · 128 without coordinates

Open the mapobservation + sensor260

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9

9 georeferenced · 301 without coordinates

Open the institutions mapphysical evidence310

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	191
MWLRlocation not on record	35
Mississippi State, US	6
San Francisco, US	1

4 institutions · 233 of 310 vouchered records shown · 75 without an institution code

09Environmental DNA84 detections

Where the DNA of Aonidiella aurantii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found84

Studies independent surveys2

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 84 detections have coordinates

Open the map7 countries0

1. Forest & Woodland | 1.5. Subtropical/Trop…3. Shrubland|3.5. Subtropical/Tropical Dry S…3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature18.0 °C 15.0–28.0

pH5.80 3.60–7.50

Conductivity44.0 µS/cm 12.0–187

Organic carbon1.46 % 0.5–4.65

Water content4.37 % 2.20–10.0

Nitrate-N2.00 mg/kg 0.5–52.0

Phosphorus7.00 mg/kg 2.00–137

Clay17.5 % 3.91–47.4

Sand71.4 % 37.5–95.1

Depth0 m 0–1.02

SoilSodosolChromosolsTenosolsRudosolDermosolsChromosol

24 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.3 °C 10.6–26.8

Seasonal swing summer↔winter10.8 °C

Max temp (day)26.0 °C 14.4–31.2

Min temp (night)15.2 °C 5.60–25.0

Precipitation54.1 mm/mo 10.2–337

Air humidity57.7 % 49.2–67.1

Moisture balance-47.2 mm/mo -107–186

Vapour deficit1,057 Pa 509–1,611

Wind speed2.00 m/s 1.50–4.60

Cloud cover30.4 % 19.7–79.8

CHELSA 1981–2010, ~9 km grid, at location & month of 54 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)