Aonides oxycephala
(Sars, 1862) · speciesAt a glance
Occurrence records16 331
Data sources8
Biological traits4
DNA specimens18
eDNA detections65
Sources8 archives
Databases and archives Aonides oxycephala's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility8 880 records↗
OBISOcean Biodiversity Information System7 451 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗
Catalogue of LifeCOLtaxonomy↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources4 traits
Occurrence & distributionGBIF · OBIS16 331 records
Environmental DNA4 datasets · 6 countries65 detections
DNA & barcodingBOLD18 specimens
01Narrative
Aonides oxycephala is een borstelworm uit de familie Spionidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Aonides oxycephala werd in 1862 voor het eerst wetenschappelijk beschreven door Sars.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Habitat & environment2
Habitat saltwateryes
Habitat zonesessile
Other traits2
Depth max507 m
Depth min0 m
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aonides oxycephala has left across the world's sequence archives.
At a glance
DNA specimens18
BINs2
Marker genes2
eDNA detections65
Countries6
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P657 bp consensus12 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.
Where individuals differ — all 145 variable positions, in barcode order
2Cmostly conserved
3Gmostly conserved
5Tmostly conserved
6Amostly conserved
7Tmostly conserved
9Tmostly conserved
10Tmostly conserved
13Amostly conserved
14Tmostly conserved
16Tmostly conserved
17Tmostly conserved
18Amostly conserved
20Gmostly conserved
21Tmostly conserved
22Gmostly conserved
23Tmostly conserved
24Gmostly conserved
28Tmostly conserved
29Cmostly conserved
32Gmostly conserved
33Tmostly conserved
36Gmostly conserved
37Tmostly conserved
40Gmostly conserved
42Amostly conserved
46Tmostly conserved
47Cmostly conserved
51Amostly conserved
52Amostly conserved
54Tmostly conserved
58Cmostly conserved
59Tmostly conserved
66Amostly conserved
69Tmostly conserved
78Tmostly conserved
81Amostly conserved
84Tmostly conserved
87Cmostly conserved
91Tmostly conserved
96Amostly conserved
102Tmostly conserved
111Tmostly conserved
126Amostly conserved
138Amostly conserved
156Tmostly conserved
157Cmostly conserved
159Tmostly conserved
165Amostly conserved
171Amostly conserved
180Gmostly conserved
183Tmostly conserved
195Amostly conserved
199Tmostly conserved
216Tmostly conserved
222Tmostly conserved
240Tmostly conserved
255Avariable
270Cmostly conserved
273Amostly conserved
282Tmostly conserved
286Cmostly conserved
288Amostly conserved
291Tmostly conserved
294Amostly conserved
300Tmostly conserved
306Amostly conserved
309Gmostly conserved
312Gmostly conserved
318Cmostly conserved
321Gmostly conserved
324Gmostly conserved
336Amostly conserved
345Tmostly conserved
354Amostly conserved
360Gmostly conserved
363Tmostly conserved
369Gmostly conserved
378Amostly conserved
399Tmostly conserved
411Tmostly conserved
414Tmostly conserved
427Cmostly conserved
432Gmostly conserved
453Amostly conserved
456Gmostly conserved
462Tmostly conserved
465Amostly conserved
471Amostly conserved
474Amostly conserved
480Amostly conserved
492Tmostly conserved
507Amostly conserved
510Amostly conserved
519Gmostly conserved
522Cmostly conserved
528Amostly conserved
531Cmostly conserved
538Cmostly conserved
541Tmostly conserved
543Amostly conserved
547Cmostly conserved
549Amostly conserved
552Tmostly conserved
555Tmostly conserved
558Gmostly conserved
573Amostly conserved
576Gmostly conserved
579Gmostly conserved
585Amostly conserved
594Tmostly conserved
597Amostly conserved
603Amostly conserved
606Cmostly conserved
612Tmostly conserved
613Gmostly conserved
614Amostly conserved
615Tmostly conserved
618Tmostly conserved
619Gmostly conserved
620Cmostly conserved
+25 more variable positions not shown
ACGTTATATTTTATTTTAGGTGTGTGGTCAGGTTTGTTAGGAACTTCAATAAGTCTTCTAATTCGAGCTGAATTAGGTCAACCTGGCTCA …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)4.2%
Haplotypes5
BINs2
Most divergent pair0.61%
Europe
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S-5P
animal barcoderibosomal
08Occurrence & distribution
Record type16 331 records
Wild obs. + sensor5 050
Museum / vouchered9 278
Other2 003
Origin
Native90
Range
Area of Occupancy AOO9 448 km²
Depth
0–200 m sunlit3 711
200–1000 m twilight6
1–4 km midnight1
>4 km abyssal0
median 21.1 m · max 1 823.7 m · 3 718 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy98% within 1 km
≤100 m 3 849≤1 km 124≤10 km 88>10 km 6
4 067 georeferenced · 983 without coordinates
Open the mapobservation + sensor5 050
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy92% within 1 km
≤100 m 120≤1 km 108≤10 km 19>10 km 2
249 georeferenced · 9 029 without coordinates
Open the institutions mapphysical evidence9 278
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions7 of 52 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| CEFASlocation not on record | 2 303 |
| Institut Francais pour l'Etude de la Merlocation not on record | 746 |
| 486location not on record | 415 |
| National Marine Biodiversity Institute of Korealocation not on record | 412 |
| DASSHlocation not on record | 144 |
| Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record | 74 |
| Sydney, AU | 49 |
| Museums Victorialocation not on record | 45 |
| Station Biologique de Roscoff (EDMO:521)location not on record | 21 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 18 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 17 |
| Laboratoria di biologia marina di Triestelocation not on record | 15 |
| Museum and Art Gallery of the Northern Territorylocation not on record | 14 |
| RWSlocation not on record | 14 |
| South Kensington, GB | 12 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 11 |
| Zoological Museum, Moscow Lomonosov State Universitylocation not on record | 11 |
| Washington, US | 10 |
| 730location not on record | 10 |
| NTNU-VMlocation not on record | 10 |
| CoNISMalocation not on record | 8 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 8 |
| PNHSlocation not on record | 8 |
| Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record | 6 |
| Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record | 6 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 5 |
| Bergen, NO | 5 |
| CZULElocation not on record | 3 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393)location not on record | 3 |
| Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record | 3 |
| Natural History Museum of the Iberian Peninsula - NatMIP ("Museu de História Natural da Península Ibérica")location not on record | 2 |
| Univ_Ryukyuslocation not on record | 2 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Phaxas Expertise Of Marine Fauna (4507)location not on record | 2 |
| Institute of Biology of the Southern Seas (IBSS), Ukrainelocation not on record | 2 |
| Natural History Museum, Londonlocation not on record | 2 |
| WoRMS Editorial Boardlocation not on record | 2 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 1 |
| Marine Biological Association of the UKlocation not on record | 1 |
| Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| University of Oslo, Natural History Museumlocation not on record | 1 |
| Hellenic Centre for Marine Research-Institute of Marine Biology, Biotechnology and Aquaculturelocation not on record | 1 |
| ARMS-MBONlocation not on record | 1 |
| Cambridge, US | 1 |
| Biomorlocation not on record | 1 |
| Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| Honolulu, US | 1 |
| 630location not on record | 1 |
| Santa Barbara Museum of Natural Historylocation not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| Gothenburg, SE | 1 |
52 institutions · 4 434 of 9 278 vouchered records shown · 90 without an institution code
09Environmental DNA65 detections
Where the DNA of Aonides oxycephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found65
Studies independent surveys4
Countries6
Verifiable raw sequence linked1
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 65 detections have coordinates
Open the map6 countries0
Special Area of Conservation; protected; 9.4…Rock creviceSand and mudin a chainMudAtlantic Ocean
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature11.6 °C 9.29–32.2
pH8.00 7.87–8.13
Conductivity51,000 µS/cm 35,000–61,326
Salinity34.2 PSU 22.1–35.6
Dissolved oxygen8.43 mg/L 7.37–9.94
Turbidity0.675 NTU 0.063–11.4
Nitrate3.40 µmol/L 0.1–3.90
Sand73.8 % 15.6–73.8
Depth18.0 m 0–85.0
PelagicSedimentCoastal water
46 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.7 °C 8.10–20.7
Seasonal swing summer↔winter6.80 °C
Max temp (day)12.9 °C 11.4–23.7
Min temp (night)8.00 °C 4.50–17.5
Precipitation65.0 mm/mo 43.5–116
Air humidity58.5 % 57.3–64.5
Moisture balance6.30 mm/mo
Vapour deficit541 Pa 435–1,056
Wind speed5.50 m/s
Cloud cover43.6 % 25.1–52.9
CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.