Anzacia gemmea

(Dalmas, 1917) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Gnaphosidae/Anzacia

At a glance

Occurrence records41

Data sources6

Biological traits8

DNA specimens8

eDNA detections0

Sources6 archives

Databases and archives Anzacia gemmea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

World Spider Trait DBMasaryk University8 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF41 records

DNA & barcodingBOLD8 specimens

01Narrative

Anzacia gemmea is een spinnensoort in de taxonomische indeling van de bodemjachtspinnen (Gnaphosidae). De spin jaagt 's nachts en verschuilt zich overdag onder rotsen en bladeren. Het lijf van de spin is ovaalvormig, smal en puntig aan de achterzijde. Het dier behoort tot het geslacht Anzacia. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1917 door Raymond Comte de Dalmas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesForster & Blest 1979

Morphometry8

Abdomen length♀3.3·♂1.7 mm

Abdomen width♀2·♂1.9 mm

Cephalothorax length♀1.9·♂2.4 mm

Cephalothorax width♀1.5·♂2.8 mm

Leg I length♀4.6·♂7.7 mm

Leg II length♀4.1·♂5 mm

Leg III length♀3.8·♂4.6 mm

Leg IV length♀5.7·♂6.5 mm

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anzacia gemmea has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Diversity (π)4.9%

Haplotypes2

BIN1

Most divergent pair1.2%

Where individuals differ — all 75 variable positions, in barcode order

2Avariable

3Cvariable

9Avariable

10Tvariable

13Avariable

14Tvariable

15Tvariable

16Gvariable

17Tvariable

18Tvariable

19Tvariable

20Gvariable

22Tvariable

25Amostly conserved

26Tmostly conserved

27Gmostly conserved

28Gmostly conserved

29Gmostly conserved

30Cmostly conserved

31Gmostly conserved

32Gmostly conserved

33Cmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

39Tmostly conserved

40Gvariable

42Gmostly conserved

43Tmostly conserved

45Cmostly conserved

47Gmostly conserved

48Cmostly conserved

50Amostly conserved

53Amostly conserved

54Gmostly conserved

56Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

61Amostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Amostly conserved

70Gmostly conserved

72Amostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Avariable

80Cmostly conserved

81Amostly conserved

82Amostly conserved

83Tmostly conserved

84Cmostly conserved

85Tmostly conserved

86Gmostly conserved

87Gmostly conserved

88Tmostly conserved

89Amostly conserved

90Gmostly conserved

127Amostly conserved

160Gmostly conserved

163Avariable

229Amostly conserved

382Amostly conserved

502Gmostly conserved

529Gmostly conserved

616Cmostly conserved

625Amostly conserved

634Tmostly conserved

AACTTTATATTTATTGTTTGGTGCATGGGCGGCTATAATGGGTACAGCAATAAGAGTATTAATTCGTATGGAATTAGGACAATCTGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Asemesthes lineatussame family13.8%Haplodrassus stuxbergisame family14.0%Gnaphosa micropssame family14.0%Thysanina absolvosame order14.0%Cicurina arcuatasame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor41

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 15≤1 km 2>10 km 1

18 georeferenced · 23 without coordinates

Open the mapobservation + sensor41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)