Anurophorus laricis

H.Nicolet, 1842 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Collembola/Entomobryomorpha/Isotomidae/Anurophorus

At a glance

Occurrence records419

Data sources6

Biological traits0

DNA specimens18

eDNA detections536

Sources6 archives

Databases and archives Anurophorus laricis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI536 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF419 records

Environmental DNA7 datasets · 7 countries536 detections

DNA & barcodingBOLD18 specimens

01Narrative

Anurophorus laricis is een springstaartensoort uit de familie van de Isotomidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1842 door Nicolet.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anurophorus laricis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections536

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

4Avariable

74Tmostly conserved

271Amostly conserved

337Avariable

406Cmostly conserved

434Gmostly conserved

476Gmostly conserved

478Cvariable

544Gmostly conserved

622Cvariable

631Avariable

AACATTATATTTGATTTTTGGTGTTTGATCAGCTATAGTAGGAACTGCATTTAGAGTTTTAATTCGATTAGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes3

BIN1

Most divergent pair0.92%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Folsomia quadrioculatasame family11.9%Siagona europaeasame order17.4%Nebria laticollissame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type419 records

Wild obs. + sensor226

Museum / vouchered193

Range

Area of Occupancy AOO1 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 60≤1 km 46≤10 km 79

185 georeferenced · 41 without coordinates

Open the mapobservation + sensor226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 64≤1 km 36≤10 km 22>10 km 1

123 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	44
Fjellberglocation not on record	32
SLU Artdatabankenlocation not on record	26
"Privolzhskaya lesostep" Nature Reservelocation not on record	21
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	14
Tromsø, NO	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
MPGUlocation not on record	3
MOLARTlocation not on record	3
NTNU University Museum, Department of Natural Historylocation not on record	2
BioFokuslocation not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Champaign, US	1

13 institutions · 165 of 193 vouchered records shown · 28 without an institution code

09Environmental DNA536 detections

Where the DNA of Anurophorus laricis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found536

Studies independent surveys7

Countries7

Verifiable raw sequence linked514

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 536 detections have coordinates

Open the map7 countries0

EUNIS G1; Moss and bark on deciduous tree stemForest1. Forest & Woodland|1.4. Temperate ForestUnder bark, Salix

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 1.80–16.6

Seasonal swing summer↔winter18.0 °C

Max temp (day)17.5 °C 3.60–20.1

Min temp (night)10.6 °C -0.1–12.8

Precipitation84.0 mm/mo 41.4–93.4

Air humidity61.1 % 59.3–68.8

Moisture balance-18.1 mm/mo -33.8–37.0

Vapour deficit616 Pa 205–751

Wind speed3.00 m/s 2.60–5.00

Cloud cover51.2 % 45.4–60.9

CHELSA 1981–2010, ~9 km grid, at location & month of 536 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)