Anurida maritima

(Guérin-Méneville, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Collembola/Poduromorpha/Neanuridae/Anurida

At a glance

Occurrence records4 059

Data sources9

Biological traits0

DNA specimens17

eDNA detections16

Sources9 archives

Databases and archives Anurida maritima's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 861 records↗

OBISOcean Biodiversity Information System2 198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS4 059 records

Environmental DNA1 datasets · 4 countries16 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceTreeOfSex2n = 8

01Narrative

Anurida maritima (seashore springtail) is a cosmopolitan collembolan of the intertidal zone. It is often found in aggregations of up to several hundred on the surface of rock-pools.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anurida maritima has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes2

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 141 variable positions, in barcode order

1Amostly conserved

4Tmostly conserved

28Gmostly conserved

37Cmostly conserved

40Amostly conserved

46Tvariable

49Amostly conserved

61Gvariable

64Cvariable

67Cvariable

76Amostly conserved

79Amostly conserved

82Gvariable

85Tmostly conserved

97Tmostly conserved

100Gvariable

106Tvariable

112Cmostly conserved

121Tmostly conserved

133Tmostly conserved

139Cmostly conserved

145Cmostly conserved

151Tmostly conserved

160Amostly conserved

163Amostly conserved

172Tmostly conserved

175Gmostly conserved

178Tvariable

190Gmostly conserved

205Cvariable

208Gmostly conserved

211Amostly conserved

214Cmostly conserved

217Amostly conserved

220Tvariable

223Tmostly conserved

226Cmostly conserved

229Avariable

232Amostly conserved

235Tmostly conserved

238Tmostly conserved

241Amostly conserved

250Cmostly conserved

253Amostly conserved

256Amostly conserved

262Gvariable

265Gvariable

277Tvariable

278Cvariable

280Tvariable

284Cmostly conserved

290Cmostly conserved

295Gvariable

298Gvariable

302Cmostly conserved

304Gmostly conserved

307Amostly conserved

319Cmostly conserved

331Amostly conserved

334Tvariable

337Cmostly conserved

343Cmostly conserved

344Cmostly conserved

346Avariable

349Tmostly conserved

355Avariable

358Tmostly conserved

359Cmostly conserved

367Cmostly conserved

370Amostly conserved

373Tmostly conserved

376Cmostly conserved

382Gvariable

386Tmostly conserved

388Gvariable

391Cmostly conserved

400Cvariable

401Cmostly conserved

403Amostly conserved

406Cmostly conserved

409Avariable

421Tmostly conserved

427Cmostly conserved

428Cvariable

433Amostly conserved

436Cmostly conserved

445Cmostly conserved

451Cvariable

454Tmostly conserved

457Cmostly conserved

463Tmostly conserved

469Tmostly conserved

473Cmostly conserved

481Gmostly conserved

484Amostly conserved

495Tvariable

496Amostly conserved

500Tmostly conserved

505Cvariable

508Gmostly conserved

511Amostly conserved

514Tmostly conserved

520Cmostly conserved

521Tmostly conserved

529Tmostly conserved

532Tmostly conserved

533Cmostly conserved

535Tmostly conserved

536Cmostly conserved

538Cmostly conserved

541Cmostly conserved

542Tmostly conserved

547Cmostly conserved

548Cmostly conserved

550Avariable

553Amostly conserved

556Amostly conserved

565Gvariable

568Amostly conserved

571Tmostly conserved

+21 more variable positions not shown

AACTTTATATTTTATTCTTGGTGGCTGGGCCTCATTCGTAGGTACTGCACTAAGAGTCCTGATCCGCCTAGAATTAGGACAGCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.6%

Haplotypes9

BINs3

Most divergent pair18.1%

EuropeN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_070280 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceTreeOfSex

The complete instruction manual Anurida maritima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 81×TreeOfSex · invert

TreeOfSex · invert — Makino S (1951) An Atlas of the Chromosome Numbers in Animals. Ames, Iowa: Iowa State College Press. ↗

08Occurrence & distribution

Record type4 059 records

Wild obs. + sensor1 726

Museum / vouchered1 870

Other463

Origin

Native1

Range

Area of Occupancy AOO5 540 km²

Depth

0–200 m sunlit14

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.9 m · max 25 m · 14 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 211≤1 km 114≤10 km 249>10 km 10

1 584 georeferenced · 142 without coordinates

Open the mapobservation + sensor1 726

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 31≤1 km 13≤10 km 17>10 km 1

62 georeferenced · 1 808 without coordinates

Open the institutions mapphysical evidence1 870

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	22
PNHSlocation not on record	15
UMUlocation not on record	9
Tromsø, NO	8
Fjellberglocation not on record	7
South Kensington, GB	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Champaign, US	4
New Haven, US	2
Edmonton, CA	2
Ciudad de México, MX	2
Cambridge, US	1
Washington, US	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Puerto Ayora, EC	1

15 institutions · 85 of 1 870 vouchered records shown · 5 without an institution code

09Environmental DNA16 detections

Where the DNA of Anurida maritima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map4 countries0

Rocks at seashore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 11.9–20.7

Seasonal swing summer↔winter14.1 °C

Max temp (day)17.4 °C 15.2–24.9

Min temp (night)12.1 °C 8.70–16.8

Precipitation73.0 mm/mo 33.9–91.6

Air humidity61.5 % 60.3–62.3

Moisture balance-51.9 mm/mo

Vapour deficit659 Pa 513–943

Wind speed4.80 m/s

Cloud cover39.1 % 35.8–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anurida maritima

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 059 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 059 records