Antonina graminis

(Maskell, 1897) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pseudococcidae/Antonina

At a glance

Occurrence records43

Data sources8

Biological traits0

DNA specimens67

eDNA detections76

Sources8 archives

Databases and archives Antonina graminis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI76 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 7 countries76 detections

DNA & barcodingBOLD67 specimens

Genome at a glanceGoaT · TreeOfSex2n = 16

01Narrative

Antonina graminis or Rhodes grass scale is a species of mealybug in the family Pseudococcidae. In the 1940s the species, originating in Asia, infested nearly 69 species fodder and turf grasses in Texas causing major economic loss. Classical biological control was made use of in the 1950s and 60s with nearly complete control achieved after the aerial introduction of a wingless encyrtid parasite from India, Neodusmetia sangwani. By 1976 the control was a complete success and nearly 17 million USD was estimated as savings due to the parasite.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antonina graminis has left across the world's sequence archives.

At a glance

DNA specimens67

BINs1

Marker genes3

eDNA detections76

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P382 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.29%

Haplotypes2

BIN1

Most divergent pair2.9%

Where individuals differ — all 2 variable positions, in barcode order

43Gmostly conserved

337Gmostly conserved

ATTAATATATTTAATTTTTGGATTTTGATCTGGATTAATAGGGCTATCAATAAGATTTATTATTCGAATTGAATTAATAAATTTAAATAA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Antonina graminis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type43 records

Wild obs. + sensor13

Museum / vouchered30

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤1 km 2>10 km 9

11 georeferenced · 2 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Universidad Nacional de Colombia (UNAL)location not on record	1

1 institutions · 1 of 30 vouchered records shown · 29 without an institution code

09Environmental DNA76 detections

Where the DNA of Antonina graminis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found76

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 76 detections have coordinates

Open the map7 countries0

1. Forest & Woodland | 1.5. Subtropical/Trop…Sabie/Crocodile Thorn Thicket3. Shrubland | 3.5. Subtropical/Tropical Dry…2. Savanna | 2.1. Dry Savanna3. Shrubland|3.5. Subtropical/Tropical Dry S…Mopane/Bushwillow Woodlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 10.0–25.8

Seasonal swing summer↔winter8.70 °C

Max temp (day)29.1 °C 15.7–31.2

Min temp (night)18.7 °C 3.10–23.1

Precipitation92.8 mm/mo 13.5–106

Air humidity57.4 % 45.7–68.5

Moisture balance-57.7 mm/mo -95.2–-30.3

Vapour deficit1,283 Pa 827–1,542

Wind speed3.10 m/s 1.80–4.50

Cloud cover37.0 % 20.5–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)