Antocha vitripennis

(Meigen, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Limoniidae/Antocha

At a glance

Occurrence records1 697

Data sources6

Biological traits2

DNA specimens12

eDNA detections9

Sources6 archives

Databases and archives Antocha vitripennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 697 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 697 records

Environmental DNA1 datasets · 5 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Antocha (Antocha) vitripennis is een tweevleugelige uit de familie steltmuggen (Limoniidae). De soort komt voor in het Palearctisch gebied.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)saprophagous

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antocha vitripennis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections9

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

13Amostly conserved

37Cmostly conserved

64Cmostly conserved

85Cmostly conserved

160Amostly conserved

172Tmostly conserved

196Amostly conserved

250Gmostly conserved

263Cmostly conserved

274Cmostly conserved

277Tmostly conserved

307Cmostly conserved

400Cmostly conserved

445Gmostly conserved

448Gmostly conserved

526Amostly conserved

532Tmostly conserved

544Gmostly conserved

616Cvariable

AGCTTGAGCAGGAATAGTGGGTACTTCTTTAAGAATCCTTATTCGAGCAGAACTAGGACATCCCGGAGCCTTAATTGGGGATGACCAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes5

BINs2

Most divergent pair2.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gonomyia simplexsame family11.2%Megaselia spinigerasame order11.4%Anopheles longipalpissame order11.4%Rachispoda michiganasame order11.5%Dicranomyia consimilissame family11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 697 records

Wild obs. + sensor1 569

Museum / vouchered108

Other20

Range

Area of Occupancy AOO3 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 965≤1 km 444≤10 km 101

1 510 georeferenced · 59 without coordinates

Open the mapobservation + sensor1 569

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 76≤1 km 7≤10 km 15

98 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	21
SLU Artdatabankenlocation not on record	8
NTNU-VMlocation not on record	7
CBDClocation not on record	5
BioFokuslocation not on record	3
DFlocation not on record	3
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	2
DFFW2018location not on record	1
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1

10 institutions · 52 of 108 vouchered records shown · 56 without an institution code

09Environmental DNA9 detections

Where the DNA of Antocha vitripennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 2.60–16.1

Seasonal swing summer↔winter21.6 °C

Max temp (day)15.1 °C 4.70–18.8

Min temp (night)7.30 °C -0.6–11.5

Precipitation73.5 mm/mo 64.3–141

Air humidity62.5 % 60.0–73.9

Moisture balance29.9 mm/mo

Vapour deficit552 Pa 243–697

Wind speed4.00 m/s

Cloud cover53.2 % 40.5–58.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antocha vitripennis

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 697 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 697 records