Antocha saxicola

Osten Sacken, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Limoniidae/Antocha

At a glance

Occurrence records14

Data sources8

Biological traits0

DNA specimens4

eDNA detections20

Sources8 archives

Databases and archives Antocha saxicola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD4 specimens

01Narrative

Antocha saxicola is a species of limoniid crane fly in the family Limoniidae, tribe Limoniini.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antocha saxicola has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes2

BIN1

Most divergent pair2.0%

Where individuals differ — all 14 variable positions, in barcode order

79Avariable

85Gvariable

166Avariable

170Avariable

352Tvariable

364Cvariable

463Tvariable

490Tvariable

544Avariable

565Gvariable

604Avariable

616Cvariable

619Avariable

649Avariable

AACATTATATTTTATTTTTGGAGCATGAGCAGGAATAGTTGGTACTTCATTGAGAATCTTAATTCGAGCAGAATTAGGACACCCGGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Telomerina chillcottisame order12.8%Tipula adustasame order12.9%Tethina spinulosasame order12.9%Simulium tarsatumsame order13.0%Phaonia aberranssame order13.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type14 records

Wild obs. + sensor3

Museum / vouchered11

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Cornell University Insect Collectionlocation not on record	2
University Park, US	2
Sydney, AU	1

4 institutions · 8 of 11 vouchered records shown · 3 without an institution code

09Environmental DNA20 detections

Where the DNA of Antocha saxicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

Beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.80 °C 5.80–14.6

Seasonal swing summer↔winter24.3 °C

Max temp (day)10.6 °C 10.6–16.8

Min temp (night)1.00 °C 1.00–13.0

Precipitation102 mm/mo 92.0–102

Air humidity55.3 % 55.3–60.1

Moisture balance26.5 mm/mo -6.80–26.5

Vapour deficit412 Pa 412–633

Wind speed5.10 m/s 3.20–5.10

Cloud cover46.7 % 45.0–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)