Antistrophus rufus

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Antistrophus

At a glance

Occurrence records39

Data sources5

Biological traits0

DNA specimens4

eDNA detections4

Sources5 archives

Databases and archives Antistrophus rufus's data was compiled from.

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF39 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antistrophus rufus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P627 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Diversity (π)5.3%

Haplotypes2

BIN1

Most divergent pair0.32%

Where individuals differ — all 66 variable positions, in barcode order

1Amostly conserved

5Tmostly conserved

6Amostly conserved

8Amostly conserved

10Tmostly conserved

13Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

22Gmostly conserved

23Tmostly conserved

26Gmostly conserved

28Tmostly conserved

29Cmostly conserved

30Amostly conserved

31Gmostly conserved

32Gmostly conserved

33Gmostly conserved

36Amostly conserved

37Amostly conserved

38Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Cmostly conserved

43Tmostly conserved

46Gmostly conserved

47Cmostly conserved

48Tmostly conserved

49Tmostly conserved

50Tmostly conserved

52Amostly conserved

53Gmostly conserved

54Amostly conserved

55Gmostly conserved

61Amostly conserved

62Tmostly conserved

64Cmostly conserved

65Gmostly conserved

66Tmostly conserved

67Amostly conserved

68Tmostly conserved

70Gmostly conserved

71Amostly conserved

73Tmostly conserved

74Tmostly conserved

75Amostly conserved

76Gmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

81Cmostly conserved

82Cmostly conserved

84Tmostly conserved

85Tmostly conserved

86Cmostly conserved

88Cmostly conserved

89Amostly conserved

91Tmostly conserved

93Amostly conserved

94Amostly conserved

95Tmostly conserved

97Gmostly conserved

98Gmostly conserved

549Gmostly conserved

590Gmostly conserved

ATATTATATTTTATTTTTGGAGTATGATCAGGGATAATCGGCTCTGCTTTAAGAGTTATTATTCGTATAGAATTAGGGACCCCTTCACAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alloxysta obscuratasame order13.6%Aulacidea folliotisame family14.4%Alloxysta macrophadnasame order14.7%Alloxysta curtasame order15.0%Alloxysta circumscriptasame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type39 records

Wild obs. + sensor5

Museum / vouchered34

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 20≤1 km 5≤10 km 2>10 km 1

28 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	26
Cambridge, US	2
University of Wisconsin, Insect Research Collectionlocation not on record	2
Chicago, US	2
University Park, US	2

5 institutions · 34 of 34 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Antistrophus rufus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)