Antispila metallella

(Denis & Schiffermüller, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Heliozelidae/Antispila

At a glance

Occurrence records380

Data sources7

Biological traits2

DNA specimens10

eDNA detections7

Sources7 archives

Databases and archives Antispila metallella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF380 records

Environmental DNA2 datasets · 5 countries7 detections

DNA & barcodingBOLD10 specimens

01Narrative

Antispila metallella is a moth of the family Heliozelidae. It is found from Scandinavia to the Pyrenees, Alps and Romania and from Great Britain to Russia. A mined dogwood leaf Larva The wingspan is 8–9 mm. Adults are bronzy metallic with paler metallic markings. They are on wing in May.Ukmoths The larvae feed on Cornus alba, Cornus mas and Cornus sanguinea. They mine the leaves of their host plant. The mine starts as a short corridor close to the leaf margin. It later widens into a large blotch, that often overruns the initial corridor. Full-grown larva make an oval excision in which they drop the ground. They continue feeding from within this excision which is now used as a case. Pupation takes place within the case. Larvae can be found from July to August.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antispila metallella has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections7

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

399Cmostly conserved

ACTATATATTTTATTTTTGGAATTTGATCTGGATTAATTGGAACATCAATAAGAATATTAATTCGGGCAGAACTAGGAACTCCTGGATCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eucrostes indigenatasame order14.3%Evergestis nolentissame order14.5%Bathycolpodes bassasame order14.8%Rhiza laciniosasame order14.9%Omphax plantariasame order14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type380 records

Wild obs. + sensor283

Museum / vouchered76

Other21

Origin

Native10

Range

Area of Occupancy AOO956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 107≤1 km 52≤10 km 112

271 georeferenced · 12 without coordinates

Open the mapobservation + sensor283

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 11≤1 km 8≤10 km 3

22 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	35
Tartu, EE	8
South Kensington, GB	6
SLU Artdatabankenlocation not on record	6
Stockholm, SE	5
DanishLepidopterologicalSocietylocation not on record	4
Natural History Museum, Londonlocation not on record	3
Salzburg, AT	1
NHMOlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

11 institutions · 71 of 76 vouchered records shown · 5 without an institution code

09Environmental DNA7 detections

Where the DNA of Antispila metallella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 7.90–15.5

Seasonal swing summer↔winter15.4 °C

Max temp (day)16.9 °C 12.2–19.2

Min temp (night)9.30 °C 2.80–11.7

Precipitation69.1 mm/mo 47.2–107

Air humidity60.7 % 58.7–61.9

Moisture balance-51.1 mm/mo -64.2–11.4

Vapour deficit600 Pa 440–696

Wind speed4.00 m/s 2.80–4.50

Cloud cover37.8 % 34.7–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)