Antispila isabella

Clemens, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Heliozelidae/Antispila

At a glance

Occurrence records77

Data sources7

Biological traits0

DNA specimens17

eDNA detections19

Sources7 archives

Databases and archives Antispila isabella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD17 specimens

01Narrative

Antispila isabella is a species of moth of the family Heliozelidae. It is found in Ontario, Connecticut, Georgia, Kentucky, New York, Pennsylvania and Vermont. However, research concludes that a complex of species is involved under this name. Mine Mine The larvae feed on Vitis aestivalis, Vitis labrusca and Vitis riparia. They mine the leaves of their host plant. The mines are relatively large. No gallery is visible and the mine has the form of a large blotch, with a roundish patch of reddish frass near the beginning, probably attached to the upper epidermis, and dispersed black frass throughout the mine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antispila isabella has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

43Amostly conserved

80Amostly conserved

238Tmostly conserved

347Cmostly conserved

391Tmostly conserved

400Tmostly conserved

604Cmostly conserved

631Gmostly conserved

646Cmostly conserved

AACTCTATATTTTATTTTTGGAATTTGATCAGGTTTAATTGGAACATCTATAAGTCTTTTAATCCGAGCTGAATTAGGTATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes6

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antispila uenoisame genus11.9%Antispila petryisame genus13.1%Berta annuliferasame order15.0%Antiblemma fulvipictasame order15.5%Heliothis nubigerasame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor37

Museum / vouchered40

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 15≤1 km 7≤10 km 2>10 km 3

27 georeferenced · 10 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤1 km 10≤10 km 15>10 km 2

27 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	25
St. Paul, US	3
Philadelphia, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

4 institutions · 31 of 40 vouchered records shown · 9 without an institution code

09Environmental DNA19 detections

Where the DNA of Antispila isabella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 16.7–25.4

Seasonal swing summer↔winter23.3 °C

Max temp (day)26.9 °C 20.9–29.9

Min temp (night)17.2 °C 12.8–23.0

Precipitation106 mm/mo 92.7–120

Air humidity60.7 % 57.9–62.1

Moisture balance-21.1 mm/mo -76.0–9.40

Vapour deficit1,029 Pa 718–1,317

Wind speed3.60 m/s 2.30–4.10

Cloud cover38.9 % 29.5–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)