Antirrhinum tortuosum

Bosc ex Vent. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Antirrhinum

At a glance

Occurrence records980

Data sources6

Biological traits7

DNA specimens1

eDNA detections15

Sources6 archives

Databases and archives Antirrhinum tortuosum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility980 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF980 records

Environmental DNA1 datasets · 3 countries15 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Antirrhinum tortuosum is a species of plant in the family Plantaginaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antirrhinum tortuosum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections15

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAY731285.1 ↗596 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAATCCCCGGGCGTCGAGCCGAGGGAGAACTCAAGTCCCTCCTCGTCGAGATGCC …

Antirrhinum tortuosum voucher VAL 39871 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK9★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type980 records

Wild obs. + sensor937

Museum / vouchered43

Range

Area of Occupancy AOO1 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 487≤1 km 92≤10 km 59>10 km 66

704 georeferenced · 233 without coordinates

Open the mapobservation + sensor937

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 10≤1 km 9≤10 km 1

20 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut und Museum fuer Geologie und Palaeontologielocation not on record	10
València, ES	9
BClocation not on record	9
MAlocation not on record	3
Granada, ES	3
College of the Atlantic, Museumlocation not on record	2
SNSNMClocation not on record	2
BRNUlocation not on record	1
LDlocation not on record	1
Córdoba, ES	1
Santiago de Compostela, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1

12 institutions · 43 of 43 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Antirrhinum tortuosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.4–24.2

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 15.7–31.4

Min temp (night)9.30 °C 3.20–16.2

Precipitation42.3 mm/mo 4.40–72.2

Air humidity54.3 % 43.8–58.3

Moisture balance-49.4 mm/mo -164–-20.6

Vapour deficit782 Pa 708–1,848

Wind speed2.70 m/s 2.60–4.30

Cloud cover34.3 % 22.6–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)