Antirrhinum siculum

Mill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Antirrhinum

At a glance

Occurrence records1 200

Data sources11

Biological traits13

DNA specimens10

eDNA detections10

Sources11 archives

Databases and archives Antirrhinum siculum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF1 200 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Antirrhinum siculum is a species of herb in the family Plantaginaceae. They have simple, broad leaves. Individuals can grow to 4 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.4 m

Seed mass0.1 mg

⚠ sources differ — TRY: 0.1 mg · GIFT: 0.08 mg

Seed mass max0.1 mg

Seed mass min0.06 mg

Life cycle & reproduction4

Life formsubshrub

Life spanannual/perennial

⚠ sources differ — TRY: annual/perennial · GIFT: perennial

Lifespan years1 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

⚠ sources differ — GIFT: herb · TRY: herb/non-woody

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Antirrhinum siculum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(2S,3R,4S,5S,6R)-2-[[(1S,2S,4S,5R,6S,10S)-5,6-dihydroxy-2-(hydroxymethyl)-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-10-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol		present	LOTUS
Antirrhinoside		present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antirrhinum siculum has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMH767008.1 ↗331 bpUSA · 2017

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Antirrhinum siculum voucher US:Scheffer8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Antirrhinum siculum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants · CCDB · CromoCat 2015

CCDB · book-fedorov — Heitz 1927b

CCDB · book-fedorov — Baur 1932

CCDB · book-atlas-flowering-plants

CCDB · CromoCat 2015 — Baur, E. (1932). Die Abstammung der Gartenrassen von Löwenmáulchen, Antirrhinum majus. Züchter 4(3): 57-61.

CCDB · CromoCat 2015 — Heitz, E. (1927a). Ueber multiple und aberrante Chromosomenzahlen. Abh. Naturwiss. Vereins Hamburg 21(3-4): 45-57.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 200 records

Wild obs. + sensor1 090

Museum / vouchered105

Other5

Range

Area of Occupancy AOO1 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 552≤1 km 133≤10 km 37>10 km 17

739 georeferenced · 351 without coordinates

Open the mapobservation + sensor1 090

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 14≤1 km 2≤10 km 1

17 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	41
València, ES	11
Rishon Le Zion, IL	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
University of Stellenboschlocation not on record	4
Museo Achille Folettolocation not on record	3
MAlocation not on record	3
Sevilla, ES	2
Salamanca, ES	2
Wlocation not on record	2
BClocation not on record	2
Berlin, DE	2
GJOlocation not on record	1
Phyletisches Museum Jenalocation not on record	1
Alicante, ES	1
PRClocation not on record	1
Barcelona, ES	1
Porvoo, FI	1
Frankfurt am Main	1
Badajoz, ES	1
Edinburgh, GB	1
Jaén, ES	1
Provincia di Livornolocation not on record	1

23 institutions · 92 of 105 vouchered records shown · 5 without an institution code

09Environmental DNA10 detections

Where the DNA of Antirrhinum siculum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–24.2

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 18.9–31.4

Min temp (night)9.30 °C 9.30–16.2

Precipitation72.2 mm/mo 4.40–72.2

Air humidity58.3 % 43.8–58.3

Moisture balance-20.6 mm/mo -164–-20.6

Vapour deficit782 Pa 782–1,848

Wind speed2.60 m/s 2.60–4.30

Cloud cover40.9 % 22.6–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antirrhinum siculum

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment4

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 200 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 200 records