Antirrhinum molle

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Antirrhinum

At a glance

Occurrence records1 133

Data sources10

Biological traits5

DNA specimens15

eDNA detections15

Sources10 archives

Databases and archives Antirrhinum molle's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF1 133 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Antirrhinum molle là một loài thực vật có hoa trong họ Mã đề. Loài này được L. mô tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formshrub

Woodinesswoody

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antirrhinum molle has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes3

GenBank sequences10

eDNA detections15

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY731268.1 ↗596 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAATCCCCGGGCGTCGAGATGAGGGAAGACGCAAGTCCCTCCTTGTCGAGACGCC …

Antirrhinum molle voucher VAL 35176 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Antirrhinum molle carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 168×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov +2

CCDB · iber-fl — Antirrhinum lopesianum Rothm. novedad para la flora espaola. Amich, F., J. A. Snchez Rodrguez, F. Gallego Martn & M. A. Snchez.Bol. Soc. Brot. ser. 262: 231-237(1989).

CCDB · ipcn-api-dl — Amich, F., J. A. S. Rodríguez, F. G. Martín & M. A. S. Anta. 1989. Antirrhinum lopesianum Rothm. novedad para la flora Española. Bol. Soc. Brot., sér. 2 62: 231–237.

CCDB · ipcn-api-dl — Bos|7caiu, M., J. Riera, E. Estrelles & J. Güemes. 1998. Mediterranean chromosome number reports 8 (977--991). Fl. Medit. 8: 280–287.

CCDB · book-fedorov — Heitz 1927a

CCDB · book-fedorov — Lawrence 1930

CCDB · book-fedorov — Baur 1932

CCDB · book-atlas-flowering-plants — Lawrence 1930

CCDB · CromoCat 2015 — Boscaiu, M., Riera, J., Estrelles, E. & Güemes, J. (1998b). Mediterranean chromosome number reports-8. Fl. Medit. 8: 280-287.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 133 records

Wild obs. + sensor811

Museum / vouchered232

Cultivated / captive2

Other88

Origin

Introduced1

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 80≤1 km 33≤10 km 190>10 km 8

311 georeferenced · 500 without coordinates

Open the mapobservation + sensor811

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 16≤1 km 29≤10 km 80>10 km 1

126 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence232

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	69
BClocation not on record	55
Barcelona, ES	35
València, ES	19
MAlocation not on record	7
Salamanca, ES	6
Alicante, ES	4
Entomological Society of Latvialocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Sant Julià de Lòria, AD	2
Vitoria, ES	2
College of the Atlantic, Museumlocation not on record	2
IPE-CSIClocation not on record	1
Bronx, US	1
Madrid, ES	1
San Sebastián, ES	1
WTUlocation not on record	1
Jaén, ES	1
CICYTEXlocation not on record	1
Museo Achille Folettolocation not on record	1
LDlocation not on record	1

22 institutions · 218 of 232 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Antirrhinum molle was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antirrhinum molle

At a glance

Sources10 archives

Life cycle & reproduction2

Habitat & environment3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 133 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 133 records