Antirrhinum majus
speciesAt a glance
Occurrence records40 194
Data sources15
Biological traits65
DNA specimens32
eDNA detections92
Sources15 archives
Databases and archives Antirrhinum majus's data was compiled from.
WikipediaWikimedia Foundation17 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility40 194 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics32 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources65 traits
Chemical compositionLOTUS · NPASS98 compounds
Occurrence & distributionGBIF40 194 records
Environmental DNA1 datasets · 6 countries92 detections
DNA & barcodingBOLD · NCBI32 specimens
Genome at a glanceCCDB · GoaT567 Mbp
01Narrative
Antirrhinum majus, the common snapdragon (often - especially in horticulture - simply "snapdragon"), is a species of flowering plant belonging to the genus Antirrhinum. The plant was placed in the family Plantaginaceae following a revision of its prior classical family, Scrophulariaceae. The common name "snapdragon", originates from the flowers' reaction to having their throats squeezed, which causes the "mouth" of the flower to snap open like a dragon's mouth. It is widely used as an ornamental plant in borders and as a cut flower. It is perennial but usually cultivated as an annual plant. The species has been in culture since the 15th century.Siegmund Seybold: Flora of Germany and neighboring countries. A book to identify wild and frequently cultivated vascular plants . Founded by Otto Schmeil , Jost Fitschen . 93. Completely revised and expanded edition. Quelle & Meyer, Wiebelsheim 2006,
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology23
Fruit length12 mm
Fruit length max15 mm
Fruit length min12 mm
Fruit width max12 mm
Fruit width min10 mm
Leaf length max65 mm
Leaf length min18 mm
Leaf mass26.46 mg
Leaf size316 mm²
Leaf width9 mm
Leaf width max20 mm
Leaf width min6 mm
Plant height0.362 m
⚠ sources differ — GIFT: 0.362 m · LEDA: 0.425 m · TRY: 0.69 m
Plant height generative0.5 m
Plant height max0.8 m
Plant height min0.3 m
Seed length0.86 mm
⚠ sources differ — TRY: 0.86 mm · GIFT: 1 mm
Seed mass0.118 mg
⚠ sources differ — TRY: 0.118 mg · LEDA: 0.114 mg · GIFT: 0.164 mg
Seed mass max0.23 mg
Seed mass min0.1 mg
Seed width1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction17
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flower colourred
Flower length max45 mm
Flower length min33 mm
Flowering endSep
Flowering startJun
Life formsubshrub
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan years4 years
⚠ sources differ — TRY: 4 years · GIFT: 3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTgarden
Leaf formelliptic
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · LEDA: semi-woody · GIFT: non-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)169 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)12.15 mm²/mg
⚠ sources differ — TRY: 12.15 mm²/mg · LEDA: 14.8 mm²/mg · GIFT: 17.2 mm²/mg
Wood density430 mg/cm³
Other traits4
Diaspore typeseed
Monocarpymonocarp
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition98 compounds
Compounds documented for Antirrhinum majus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aminoacids15
Flavones8
Iridoids monoterpenoids8
Branched fatty acids7
Anthocyanidins6
Documented compounds98 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Valine | present | LOTUS | |
| (-)-Cystine | present | LOTUS | |
| (14S)-14-Methylhexadecanoic acid | present | LOTUS | |
| (16S)-16-methyloctadecanoic acid | present | LOTUS | |
| (1S,4aS,5S,6R,7R,7aS)-6-chloro-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4a,5,7-triol | present | LOTUS | |
| (2R,3R,4R,5S,6R)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid | present | NPASS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[[(1R,2R,4S,5R,6S,10S)-5-hydroxy-2-methyl-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-10-yl]oxy]oxane-3,4,5-triol | present | LOTUS | |
| (2R,4S)-4-hydroxypyrrolidine-2-carboxylic acid | present | LOTUS | |
| (2S)-2-ammonio-3-(4-hydroxyphenyl)propanoate | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-[[(1S,4aR,6S,7aS)-6-hydroxy-7-methylidene-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS |
05DNA & barcoding32 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antirrhinum majus has left across the world's sequence archives.
At a glance
DNA specimens32
Marker genes6
GenBank sequences10
eDNA detections92
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Antirrhinum majus isolate FM17_Leaf 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL5★rbcLa★ITS5★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Antirrhinum majus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size567 240 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Antirrhinum majus0.57 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–322n range16median16mode47records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1639×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · nw-europe-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. Fernandes, A., M. Queirs & M. F. Santos.Bol. Soc. Brot. ser. 251: 37-90(1977).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3599
CCDB · fl-europaea — Bjbrkqvist et al., 1969
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · ipcn-api-dl — Bastida, F. & S. Talavera. 1994. Nǔmeros cromosomăticos de plantas occidentales, 688--695. Anales Jard. Bot. Madrid 51(2): 279–280.
CCDB · ipcn-api-dl — Boscaiu, M., J. Riera, E. Estrelles & J. Güemes. 2000. Números cromosomáticos de plantas occidetales, 827--848. Anales Jard. Bot. Madrid 58(1): 163–164.
CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-indian_vol1 — Tischler, G. 1920; Baur, E. 1924, 1932; Winge, b. 1925; Heitz, E. 1927a, b; Vilmorin, R. de & Simonet, M. 1927b ; Propach, H. 1934, 1935 ; Straub, J. 1939 ; Belling (Tischler, G. 1950) ; Rieger, R. 1957, 1958 ; Afanassjeva, A.S. (Fedorov); Ortiz, E. 1961 ; Stubbe, H. 1966 ; Bhatta charyya, N.K. 1967; Verma, S.C. & Dhillon, S.S. 1967 ; Bose, S. and Pani- grahi, U.C. 1969b; Gill, L.S. 1971e; Vij, S.P. & Kashyap, S.K. 1976a
CCDB · book-fedorov — Baur 1932
CCDB · book-fedorov — Heitz 1927b
CCDB · book-atlas-flowering-plants — Propach 1935
CCDB · book-atlas-flowering-plants
CCDB · kew — Zaitlin D, Pierce AJ. 2010. Nuclear DNA content in Sinningia (Gesneriaceae); intraspecific genome size variation and genome characterization in S. speciosa. Genome 53: 1066-1082.
CCDB · kew — Castro M, Castro S, Loureiro J. 2012. Genome size variation and incidence of polyploidy in Scrophulariaceae sensu lato from the Iberian Peninsula. AoB Plants 2012: psl037.
CCDB · Cave1963 — Ortiz 1961
CCDB · CromoCat 2015 — Baur, E. (1924). Untersuchungen über das Wesen, die Entstehung und die Verer bung von Rassenunterschieden bei Antirrhinum majus. Bibliogr. Genet. 4: 1-170.
CCDB · CromoCat 2015 — Baur, E. (1932). Die Abstammung der Gartenrassen von Löwenmáulchen, Antirrhinum majus. Züchter 4(3): 57-61.
CCDB · CromoCat 2015 — Michaelis, A. (1959). Uber das Verhalten eines Ringchromosoms in der Mitose und Meiose von Antirrhinum majus L. Chromosoma 10: 144-162.
CCDB · CromoCat 2015 — Rudorf-Lauritzen, M. (1958). The trisomics of Antirrhinum majus L. Proc. X Int. Congr. Genet. 2: 243-244.
CCDB · CromoCat 2015 — Tischler, G. (1920). Über die sogenannten Erbsubstanzen und ihre lokalisation in der pflanzenselle. Biol. Zentralbl. 40: 15-28.
CCDB · CromoCat 2015 — Bastida, F. & Talavera, S. (1994). Números cromosomáticos de plantas occidentales, 688--695. Anales Jard. Bot. Madrid 51(2): 279-280.
CCDB · CromoCat 2015 — Bastida, F. (1994). Números cromosomáticos de plantas occidentales, 688-695. Anales Jard. Bot. Madrid 51(2): 279-280.
CCDB · CromoCat 2015 — Björkqvist, I., von Bothmer, R., Nilsson, O. & Nordenstam, B. (1969). Chromosome numbers in Iberian angiosperms. Bot. Not. 122: 271-283.
CCDB · CromoCat 2015 — Fernandes, A., Queirós, M. & Santos, M. F. (1977b). Contribution à la connaissance cytotaxinomique des Spermatophytes du Portugal. Bol. Soc. Brot. 51: 37-90.
CCDB · CromoCat 2015 — Boscaiu, M., Riera, J., Estrelles, E. & Güemes, J. (2000). Números cromosomáticos de plantas occidentales, 827-848. Anales Jard. Bot. Madrid 58(1): 163-164.
2n 183×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Breslawetz, L. (Fedorov)
CCDB · book-fedorov — BpecnaBe~ 1916
CCDB · book-fedorov — BpecnaBe~
2n 323×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Bamford, R. & Winkler, F.B. 1941; Morrison, J.W. & Rajhathy, T. 1960a; Khoshoo, T.N. 1979
CCDB · book-fedorov — Bamford, Winkler 1941
CCDB · book-fedorov — Morrison J. W., Rajhathy 1960a
2n 242×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Subramanian, D. & R. Pondmudi. 1987. Cytotaxonomical studies of south Indian Scrophulariaceae. Cytologia 52: 529–541.
CCDB · CromoCat 2015 — Subramanian, D. & R. Pondmudi. (1987). Cytotaxonomical studies of South Indian Scrophulariaceae. Cytologia 52: 529-541.
n 813×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · book-ipcn67-71 — BOSE, s., & u.c. PANIGRAHI. 1969. Effect of colchicine on three varietis of Antirrhinum majus L. Nuclesu 12: 159-166.
CCDB · book-ipcn67-71 — VERMA, S. C., & S. S. DHILLON. 1967. In IOPB chromosome number reports XI. Taxon 16: 215-222.
CCDB · book-ipcn67-71 — GILL, L.S. 1971. Chromosome numbers in certain West-Himalayan bicarpellate species. Bull. Torrey Bot. Club 98: 281.
CCDB · book-ipcn75-78 — Vij & Kashyap 1976
CCDB · book-ipcn75-78 — Kaul et al. 1976b
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · Cave1958 — Rieger 1957,1958
CCDB · CromoCat 2015 — Bose, S. & Panigrahi, U. C. (1969). Effect of colchicine on three varietis of Antirrhinum majus L. Nucleus 12: 159-166.
CCDB · CromoCat 2015 — Gill, L. S. (1971). Chromosome numbers in certain West-Himalayan bicarpellate species. Bull. Torrey Bot. Club 98: 281.
CCDB · CromoCat 2015 — Vasudevan, K. N. (1975b). Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alpes). Part II. Ber. Schweiz. Bot. Ges. (Bull. Soc. Bot. Suisse) 85: 210-252.
CCDB · CromoCat 2015 — Verma, S. C. & S. S. Dhillon. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XI]. Taxon 16(3): 215-222.
n 122×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Subramanian, D. & R. Pondmudi. 1987. Cytotaxonomical studies of south Indian Scrophulariaceae. Cytologia 52: 529–541.
CCDB · CromoCat 2015 — Subramanian, D. & R. Pondmudi. (1987). Cytotaxonomical studies of South Indian Scrophulariaceae. Cytologia 52: 529-541.
n 161×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Trivedi, M.P. & R.N. Trivedi (1992). Chromosomal behaviour in weeds. Glimpes Cytogenet. India 3:188-198
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~5.85 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.85 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type40 194 records
Wild obs. + sensor38 293
Museum / vouchered1 468
Cultivated / captive10
Other423
Origin
Native59
Introduced3 432
Range
Area of Occupancy AOO79 352 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy54% within 1 km
≤100 m 12 354≤1 km 5 346≤10 km 14 761>10 km 213
32 674 georeferenced · 5 619 without coordinates
Open the mapobservation + sensor38 293
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy60% within 1 km
≤100 m 187≤1 km 158≤10 km 221>10 km 13
579 georeferenced · 889 without coordinates
Open the institutions mapphysical evidence1 468
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 2
4 georeferenced · 6 without coordinates
Open the mapnot free-living10
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions124 of 205 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 137 |
| SLU Artdatabankenlocation not on record | 65 |
| Görlitz, DE | 51 |
| València, ES | 48 |
| LDlocation not on record | 45 |
| Allentown, US | 42 |
| Oskarshamn, SE | 40 |
| Olocation not on record | 34 |
| BFLlocation not on record | 34 |
| Barcelona, ES | 32 |
| BDBClocation not on record | 30 |
| Philadelphia, US | 26 |
| Christchurch, NZ | 23 |
| Karlsruhe, DE | 23 |
| South Kensington, GB | 22 |
| DBF-NHMDlocation not on record | 22 |
| Provincia di Livornolocation not on record | 21 |
| BClocation not on record | 20 |
| Auckland, NZ | 19 |
| San Sebastián, ES | 18 |
| CICYTEXlocation not on record | 16 |
| MAlocation not on record | 16 |
| Beijing, CN | 15 |
| Saint Louis, US | 13 |
| Salzburg, AT | 13 |
| Durango, MX | 13 |
| KMNlocation not on record | 11 |
| Chongqing Museumlocation not on record | 11 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| Wellington, NZ | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| Bern, CH | 9 |
| Berlin, DE | 8 |
| Tartu, EE | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Moscow State Universitylocation not on record | 8 |
| Hobart, AU | 8 |
| Zürich, CH | 8 |
| Zhengzhou, CN | 7 |
| Wlocation not on record | 7 |
| University of Stellenboschlocation not on record | 7 |
| Vancouver, CA | 7 |
| WTUlocation not on record | 7 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| Mexico City, MX | 6 |
| Guatemala City, GT | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Stockholm, SE | 6 |
| Paris, FR | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| BRNUlocation not on record | 5 |
| Denver, US | 5 |
| Pamplona, ES | 5 |
| Rishon Le Zion, IL | 5 |
| UChlocation not on record | 5 |
| Universidad de Antioquia (UdeA)location not on record | 4 |
| Tsukuba, JP | 4 |
| Porrentruy, CH | 4 |
| Kuopio, FI | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Santa Barbara, US | 4 |
| Taipei, TW | 4 |
| Madison, US | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Taipei, TW | 3 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 3 |
| SNSNMClocation not on record | 3 |
| Bourges, FR | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Ann Arbor, US | 3 |
| Pullman, US | 3 |
| Uppsala, SE | 3 |
| PUC-RSlocation not on record | 3 |
| Bangkok, TH | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Trondheim, NO | 3 |
| Burlington, US | 3 |
| UNESP, Campus São José Rio Prêtolocation not on record | 3 |
| Bronx, US | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Philadelphia, US | 3 |
| Victoria, CA | 3 |
| Brussel, BE | 3 |
| Rotorua, NZ | 3 |
| GJOlocation not on record | 3 |
| PRClocation not on record | 3 |
| UIBlocation not on record | 3 |
| Boise, US | 3 |
| Vitoria, ES | 3 |
| University of New Hampshirelocation not on record | 3 |
| Córdoba, ES | 3 |
| Bergen, NO | 2 |
| Monastir, TN | 2 |
| TAFORI-LSRClocation not on record | 2 |
| Davenport, US | 2 |
| Portland, US | 2 |
| Nijmegen, NL | 2 |
| Mlocation not on record | 2 |
| Sevilla, ES | 2 |
| College Park, US | 2 |
| La Paz, BO | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Dresden, DE | 2 |
| Riverside, US | 2 |
| Riobamba, EC | 2 |
| Córdoba, AR | 2 |
| ESP003location not on record | 2 |
| Nanjing, CN | 2 |
| Chengdu, CN | 2 |
| Madrid, ES | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| Wuhan, CN | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Claremont, US | 2 |
| Alexandria Universitylocation not on record | 2 |
| New Haven, US | 2 |
| Salamanca, ES | 2 |
| Acadia Universitylocation not on record | 1 |
| Tampa, US | 1 |
| Corvallis, US | 1 |
| Porvoo, FI | 1 |
| EEZA-CSIClocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Coimbra, PT | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| St. Paul, US | 1 |
| Madrid, ES | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Tokushima, JP | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Saint John, CA | 1 |
| Pondicherry, IN | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Badajoz, ES | 1 |
| WNNUlocation not on record | 1 |
| Seoul, KR | 1 |
| Xinxiang, CN | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Guangzhou, CN | 1 |
| BSBIlocation not on record | 1 |
| Kew, GB | 1 |
| Otaru, JP | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| BISHlocation not on record | 1 |
| HUN003location not on record | 1 |
| Banyoles, ES | 1 |
| Awka, NG | 1 |
| IPE-CSIClocation not on record | 1 |
| Oulu, FI | 1 |
| Chapingo, MX | 1 |
| Jaén, ES | 1 |
| LfUlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| EL PASO, US | 1 |
| Washington, US | 1 |
| Tallinn, EE | 1 |
| McWane Science Centerlocation not on record | 1 |
| H-Zimmerlocation not on record | 1 |
| Yangling, CN | 1 |
| Jyväskylä, FI | 1 |
| Sant Julià de Lòria, AD | 1 |
| TUR-Alocation not on record | 1 |
| Jinghong, CN | 1 |
| Mississippi State, US | 1 |
| JBSlocation not on record | 1 |
| Puerto Ayora, EC | 1 |
| Guilin, CN | 1 |
| ASUlocation not on record | 1 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 1 |
| Turku, FI | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Bloomington, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Knoxville, US | 1 |
| Rovaniemi, FI | 1 |
| Armidale, AU | 1 |
| Chadron, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Sanda, JP | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Firenze, IT | 1 |
| San Isidro, AR | 1 |
| Zürich, CH | 1 |
| HUAlocation not on record | 1 |
| Davis, US | 1 |
| Turlock, US | 1 |
| Baroda, IN | 1 |
| KR | 1 |
| Tulane Universitylocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Flagstaff, US | 1 |
| Smithfield, AU | 1 |
| San Luis Obispo, US | 1 |
| Long Beach, US | 1 |
205 institutions · 1 316 of 1 468 vouchered records shown · 140 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA92 detections
Where the DNA of Antirrhinum majus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found92
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 92 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 11.3–15.2
Seasonal swing summer↔winter21.1 °C
Max temp (day)20.1 °C 15.1–20.1
Min temp (night)9.00 °C 7.30–9.00
Precipitation33.4 mm/mo 33.4–76.5
Air humidity52.9 % 52.9–62.5
Moisture balance-61.7 mm/mo -61.7–-8.00
Vapour deficit953 Pa 552–953
Wind speed2.00 m/s 2.00–4.60
Cloud cover38.3 % 38.3–41.8
CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.