Antirrhea pterocopha

Godman & Salvin, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Antirrhea

At a glance

Occurrence records60

Data sources6

Biological traits0

DNA specimens7

eDNA detections7

Sources6 archives

Databases and archives Antirrhea pterocopha's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Antirrhea pterocopha is een vlinder uit de familie Nymphalidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1868 door Frederick DuCane Godman & Osbert Salvin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antirrhea pterocopha has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

25Cvariable

82Cmostly conserved

139Tmostly conserved

166Amostly conserved

169Tmostly conserved

181Gmostly conserved

184Amostly conserved

202Cmostly conserved

263Tmostly conserved

364Cmostly conserved

400Tmostly conserved

466Gmostly conserved

478Gvariable

514Tmostly conserved

520Gvariable

535Gmostly conserved

553Tmostly conserved

562Cmostly conserved

589Tmostly conserved

619Tmostly conserved

625Tmostly conserved

628Gmostly conserved

643Amostly conserved

AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATAATTGGAACCTCCCTTAGTCTTATTATTCGAACTGAACTCGGTAACCCAAACTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes3

BINs2

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heteropsis iboinasame family12.8%Lethe insanasame family12.9%Oeneis alpinasame family13.1%Ypthima arctoussame family13.2%Lethe chandicasame family13.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor17

Museum / vouchered43

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 6

14 georeferenced · 3 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 4

6 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	35
Cambridge, US	2
University of Memphislocation not on record	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Chicago, US	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

7 institutions · 43 of 43 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Antirrhea pterocopha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 21.5–23.7

Seasonal swing summer↔winter2.20 °C

Max temp (day)25.5 °C 24.9–27.1

Min temp (night)19.2 °C 18.2–21.2

Precipitation314 mm/mo 121–456

Air humidity73.4 % 69.8–78.6

Moisture balance199 mm/mo -24.9–333

Vapour deficit720 Pa 604–777

Wind speed3.70 m/s 1.50–6.40

Cloud cover28.9 % 16.2–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)