Antipodocottus elegans

Fricke & Brunken, 1984 · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Cottidae/Antipodocottus

At a glance

Occurrence records116

Data sources8

Biological traits4

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Antipodocottus elegans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

OBISOcean Biodiversity Information System64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS116 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Antipodocottus elegans or the dwarf sculpin is a species of sculpin in the family Cottidae. Most commonly found in the benthic zone around depths of 400 meters, A. elegans is found almost exclusively near Wollongong in New South Wales, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max403 m

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antipodocottus elegans has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P665 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.75%

Haplotypes1

BIN1

Where individuals differ — all 7 variable positions, in barcode order

39Avariable

175Gvariable

581Tvariable

582Gvariable

583Cvariable

584Tvariable

663Cvariable

ATTGGCACCCTGTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACAGCCCTAAGCCTCCTAATTCGAGCTGAGCTGAGCCAACCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Icelinus fimbriatussame family9.8%Icelinus borealissame family10.4%Icelinus burchamisame family10.7%Gymnocanthus tricuspissame family10.8%Icelinus filamentosussame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type116 records

Wild obs. + sensor35

Museum / vouchered81

Range

Area of Occupancy AOO144 km²

Depth

0–200 m sunlit1

200–1000 m twilight28

1–4 km midnight0

>4 km abyssal0

median 492 m · max 702 m · 29 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 33

35 georeferenced

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 9≤1 km 21≤10 km 35

65 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	18
Sydney, AU	12
Museums Victorialocation not on record	2
FishBaselocation not on record	1
Natick, US	1

5 institutions · 34 of 81 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Antipodocottus elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 13.5–19.6

Seasonal swing summer↔winter4.40 °C

Max temp (day)16.6 °C 14.4–20.4

Min temp (night)14.7 °C 12.5–18.7

Precipitation67.3 mm/mo 16.8–95.4

Air humidity60.0 % 59.6–60.9

Vapour deficit721 Pa 620–896

Cloud cover14.3 % 9.80–32.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)