Antipathes griggi — The Life Data

Animalia/Cnidaria/Anthozoa/Antipatharia/Antipathidae/Antipathes

At a glance

Occurrence records388

Data sources8

Biological traits2

DNA specimens5

eDNA detections3

Sources8 archives

Databases and archives Antipathes griggi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility222 records↗

OBISOcean Biodiversity Information System166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS388 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD5 specimens

01Narrative

Antipathes griggi is een Antipathariasoort uit de familie van de Antipathidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2009 door Opresko.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antipathes griggi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 593 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATGATAAGTGAATTTTTAACTCGTTGAGTGTTTTCCACAAACCATAAAGATATCGGTACATTATATCTAGTATTTGGAATAGGGTCCGGT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type388 records

Wild obs. + sensor250

Museum / vouchered138

Range

Area of Occupancy AOO196 km²

Depth

0–200 m sunlit165

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 70 m · max 242 m · 166 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 58≤1 km 179≤10 km 4>10 km 3

244 georeferenced · 6 without coordinates

Open the mapobservation + sensor250

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 2

12 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	43
USCBMlocation not on record	1

2 institutions · 44 of 138 vouchered records shown · 39 without an institution code

09Environmental DNA3 detections

Where the DNA of Antipathes griggi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.