Antipathes grandis

Verrill, 1928 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Antipatharia/Antipathidae/Antipathes

At a glance

Occurrence records362

Data sources7

Biological traits5

DNA specimens8

eDNA detections3

Sources7 archives

Databases and archives Antipathes grandis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility195 records↗

OBISOcean Biodiversity Information System167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS362 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD8 specimens

01Narrative

Antipathes grandis is een Antipathariasoort uit de familie van de Antipathidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1928 door Verrill.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max120 m

Depth min30 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antipathes grandis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P812 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

597Gmostly conserved

ATGATAAGTGAATTTTTAACTCGTTGAGTGTTTTCCACAAACCATAAAGATATCGGTACATTATATCTAGTATTTGGAATAGGGTCCGGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leiopathes glaberrimasame order7.8%Chrysopathes formosasame order10.8%Corynactis californicasame order14.8%Stomphia didemonsame order15.3%Rhodactis indosinensissame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_088052 ↗ · 14 protein · 2 tRNA · 2 rRNA

COX1HEGND4LCOX2ND4ND6ATP8ATP6ND5ND1ND3ND2CYTBCOX312S ribosomal RNA16S ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type362 records

Wild obs. + sensor237

Museum / vouchered125

Range

Area of Occupancy AOO116 km²

Depth

0–200 m sunlit160

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 92 m · max 455 m · 165 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 28≤1 km 208>10 km 1

237 georeferenced

Open the mapobservation + sensor237

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 6

7 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	40
Natick, US	1

2 institutions · 41 of 125 vouchered records shown · 35 without an institution code

09Environmental DNA3 detections

Where the DNA of Antipathes grandis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)