Antiophlebia bracteata

Felder, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Antiophlebia

At a glance

Occurrence records199

Data sources6

Biological traits0

DNA specimens29

eDNA detections30

Sources6 archives

Databases and archives Antiophlebia bracteata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 8 countries30 detections

DNA & barcodingBOLD29 specimens

01Narrative

Antiophlebia bracteata is een vlinder uit de familie spinneruilen (Erebidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1874 door Felder. De soort komt voor in tropisch Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiophlebia bracteata has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections30

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

13Tmostly conserved

53Tmostly conserved

85Tmostly conserved

157Amostly conserved

190Tmostly conserved

196Amostly conserved

214Amostly conserved

232Cmostly conserved

265Tmostly conserved

280Tmostly conserved

391Tmostly conserved

397Cmostly conserved

425Cvariable

457Tmostly conserved

497Tmostly conserved

544Cmostly conserved

613Cmostly conserved

625Amostly conserved

TTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTTGGAACATCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCAGGTTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.78%

Haplotypes12

BIN1

Most divergent pair2.9%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa rufulasame order6.3%Mosopia eudoxusalissame family6.7%Euxoa obeliscasame order6.9%Euxoa diaphorasame order6.9%Ceromacra tymbersame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type199 records

Wild obs. + sensor184

Museum / vouchered15

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 99≤1 km 17≤10 km 4>10 km 8

128 georeferenced · 56 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	8
New Haven, US	2
ZSMlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
National Museums of Kenyalocation not on record	1

5 institutions · 13 of 15 vouchered records shown · 2 without an institution code

09Environmental DNA30 detections

Where the DNA of Antiophlebia bracteata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map8 countries0

3. Shrubland | 3.6. Subtropical/Tropical Moi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 17.8–23.2

Seasonal swing summer↔winter7.20 °C

Max temp (day)25.9 °C 19.9–28.4

Min temp (night)16.2 °C 13.7–19.5

Precipitation88.9 mm/mo 25.0–137

Air humidity60.3 % 53.9–62.3

Moisture balance-46.4 mm/mo -88.3–42.7

Vapour deficit1,055 Pa 788–1,249

Wind speed2.60 m/s 1.90–4.50

Cloud cover31.5 % 14.7–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)