Antiopha multilinea

Schaus, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Antiopha

At a glance

Occurrence records140

Data sources6

Biological traits0

DNA specimens55

eDNA detections52

Sources6 archives

Databases and archives Antiopha multilinea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 5 countries52 detections

DNA & barcodingBOLD55 specimens

01Narrative

Antiopha multilinea is een vlinder uit de familie van de tandvlinders (Notodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1901 door Schaus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiopha multilinea has left across the world's sequence archives.

At a glance

DNA specimens55

BINs3

Marker genes1

eDNA detections52

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

1Cmostly conserved

5Tmostly conserved

40Tmostly conserved

49Tmostly conserved

52Cmostly conserved

82Tmostly conserved

85Tmostly conserved

121Cmostly conserved

154Tmostly conserved

160Gmostly conserved

163Cvariable

181Amostly conserved

197Tmostly conserved

199Amostly conserved

202Cmostly conserved

205Amostly conserved

208Tmostly conserved

212Tmostly conserved

217Tmostly conserved

220Cmostly conserved

244Gvariable

340Tmostly conserved

364Tmostly conserved

370Tmostly conserved

394Tmostly conserved

403Cmostly conserved

412Cvariable

418Cmostly conserved

445Cmostly conserved

463Cmostly conserved

542Tmostly conserved

616Tmostly conserved

622Tmostly conserved

631Gmostly conserved

646Tmostly conserved

CACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTCTCAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes6

BINs3

Most divergent pair4.9%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heteropygas ziczacsame order7.9%Didugua leonasame family7.9%Auchmophanes ochrospilasame order8.1%Elasmia schausisame family8.1%Gabala argentatasame order8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type140 records

Wild obs. + sensor17

Museum / vouchered123

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 6≤10 km 1>10 km 3

12 georeferenced · 5 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 123 records without

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	99
Smithsonian Tropical Research Institutelocation not on record	3
University of Pennsylvanialocation not on record	2

3 institutions · 104 of 123 vouchered records shown · 19 without an institution code

09Environmental DNA52 detections

Where the DNA of Antiopha multilinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map5 countries0

Forest1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.1–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.8 °C 25.8–28.6

Min temp (night)21.9 °C 20.7–23.7

Precipitation288 mm/mo 78.9–477

Air humidity70.8 % 65.5–75.7

Moisture balance179 mm/mo -60.7–339

Vapour deficit849 Pa 707–1,119

Wind speed2.00 m/s 1.10–3.60

Cloud cover34.2 % 15.2–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)