Antiopella fusca

(O'Donoghue, 1924) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Janolidae/Antiopella

At a glance

Occurrence records1 916

Data sources8

Biological traits4

DNA specimens18

eDNA detections17

Sources8 archives

Databases and archives Antiopella fusca's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 844 records↗

OBISOcean Biodiversity Information System72 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 916 records

Environmental DNA1 datasets · 3 countries17 detections

DNA & barcodingBOLD18 specimens

01Narrative

Janolus fuscus is a species of sea slug, or more accurately a nudibranch, a marine gastropod mollusk in the family Proctonotidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiopella fusca has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes2

eDNA detections17

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

7Amostly conserved

10Tmostly conserved

11Amostly conserved

13Tmostly conserved

14Cmostly conserved

19Gmostly conserved

22Gmostly conserved

28Gmostly conserved

70Tmostly conserved

94Cmostly conserved

109Tmostly conserved

214Tmostly conserved

298Amostly conserved

319Tmostly conserved

346Tmostly conserved

352Amostly conserved

364Tmostly conserved

499Tmostly conserved

516Tmostly conserved

538Gmostly conserved

541Amostly conserved

542Cmostly conserved

571Cvariable

580Gmostly conserved

604Amostly conserved

607Gmostly conserved

610Tmostly conserved

616Cmostly conserved

622Amostly conserved

628Cmostly conserved

634Tmostly conserved

636Cmostly conserved

641Cmostly conserved

AACCTTATATATTCTTTTGGGGATGTGGTGTGGCCTAGTGGGGACTGGTTTAAGTTTGCTTATTCGTTTTGAATTAGGAACTCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes5

BIN1

Most divergent pair1.1%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 916 records

Wild obs. + sensor1 857

Museum / vouchered59

Range

Area of Occupancy AOO2 280 km²

Depth

0–200 m sunlit25

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 7.5 m · max 22 m · 25 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 904≤1 km 355≤10 km 90>10 km 328

1 677 georeferenced · 180 without coordinates

Open the mapobservation + sensor1 857

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 6≤10 km 5>10 km 3

16 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Washington, US	6
Florida Museum of Natural Historylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Smithsonian Environmental Research Centerlocation not on record	1
National Marine Biodiversity Institute of Korealocation not on record	1

6 institutions · 18 of 59 vouchered records shown · 4 without an institution code

09Environmental DNA17 detections

Where the DNA of Antiopella fusca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

subtidalrocky reefrocky reef, high current habitatsoft sediment, shell hashrocky reef, wall, high current habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 5.20–14.1

Seasonal swing summer↔winter11.0 °C

Max temp (day)14.7 °C 7.50–17.7

Min temp (night)7.50 °C 1.50–12.1

Precipitation111 mm/mo 63.2–169

Air humidity64.1 % 60.6–68.7

Moisture balance19.9 mm/mo

Vapour deficit486 Pa 303–569

Wind speed4.10 m/s

Cloud cover45.8 % 37.6–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antiopella fusca

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Record type1 916 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 916 records