Antiopella cristata

(Delle Chiaje, 1841) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Janolidae/Antiopella

At a glance

Occurrence records7 594

Data sources9

Biological traits2

DNA specimens28

eDNA detections8

Sources9 archives

Databases and archives Antiopella cristata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 986 records↗

OBISOcean Biodiversity Information System2 608 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF · OBIS7 594 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD28 specimens

01Narrative

Antiopella cristata, sometimes known by the common name crested aeolis, is a species of nudibranch, a marine gastropod mollusc in the family Janolidae.Gary R. McDonald Nudibranch Systematic Index (2nd ed.), University of California Santa Cruz University of California Santa Cruz in Institute of Marine Sciences, (2009).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition2 compounds

Compounds documented for Antiopella cristata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(2S)-N-[(2R,3R,4R)-5-[(5R)-3,3-dimethyl-2,4-dioxo-5-propan-2-ylpyrrolidin-1-yl]-3-hydroxy-4-methyl-5-oxopentan-2-yl]-2-(methylamino)propanamide		present	LOTUS
Janolusimide		present	LOTUS

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiopella cristata has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes3

eDNA detections8

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

85Amostly conserved

206Tmostly conserved

406Tmostly conserved

412Gmostly conserved

416Amostly conserved

439Cvariable

598Tmostly conserved

628Amostly conserved

CACCTTATACATACTTCTTGGTATTTGGTGTGGTTTGGTGGGTACAGGTCTTAGCTTACTAATTCGATTTGAGTTGGGGACAGCAGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes11

BIN1

Most divergent pair0.79%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type7 594 records

Wild obs. + sensor5 015

Museum / vouchered2 431

Other148

Range

Area of Occupancy AOO5 488 km²

Depth

0–200 m sunlit2 117

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 14.5 m · max 118.5 m · 2 117 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 3 127≤1 km 262≤10 km 93>10 km 9

3 491 georeferenced · 1 524 without coordinates

Open the mapobservation + sensor5 015

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 13≤1 km 10≤10 km 4>10 km 3

30 georeferenced · 2 401 without coordinates

Open the institutions mapphysical evidence2 431

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	14
PNHSlocation not on record	8
Bergen, NO	6
Citadel Hill, GB	3
Naturalis Biodiversity Centerlocation not on record	2
University Museum of Bergen, Natural History Collectionslocation not on record	2
Paris, FR	2
South Kensington, GB	2
CEFASlocation not on record	2
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
NTNU-VMlocation not on record	1
RWSlocation not on record	1

12 institutions · 44 of 2 431 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Antiopella cristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

On rockRockRock with bryozoa

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 2.00–12.7

Seasonal swing summer↔winter11.6 °C

Max temp (day)12.2 °C 2.90–13.5

Min temp (night)10.2 °C -0.4–11.9

Precipitation82.0 mm/mo 44.0–267

Air humidity66.1 % 64.9–66.8

Vapour deficit468 Pa 235–501

Cloud cover54.4 % 39.6–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antiopella cristata

At a glance

Sources9 archives

Habitat & environment2

Documented compounds2 total

At a glance

Record type7 594 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 594 records