Antimima cryptica

Turner, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Antimima

At a glance

Occurrence records31

Data sources6

Biological traits0

DNA specimens28

eDNA detections27

Sources6 archives

Databases and archives Antimima cryptica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD28 specimens

01Narrative

Antimima cryptica is een vlinder uit de familie van de tandvlinders (Notodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1917 door Turner.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antimima cryptica has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections27

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.58%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 12 variable positions, in barcode order

127Gvariable

235Cmostly conserved

313Cvariable

340Cmostly conserved

346Cmostly conserved

544Gmostly conserved

574Cmostly conserved

589Cmostly conserved

601Tmostly conserved

607Cmostly conserved

619Gmostly conserved

628Gvariable

AACTCTTTATTTTATCTTCGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antimima corystessame genus8.5%Oxyodes scrobiculatasame order9.4%Negeta phaeopeplasame order9.4%Munona iridescenssame order9.4%Munona robpuschendorfisame order9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor20

Museum / vouchered11

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 5≤1 km 4≤10 km 5>10 km 2

16 georeferenced · 4 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	5
Museums Victorialocation not on record	3
Australian National Insect Collectionlocation not on record	1

3 institutions · 9 of 11 vouchered records shown · 2 without an institution code

09Environmental DNA27 detections

Where the DNA of Antimima cryptica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 14.1–23.5

Seasonal swing summer↔winter9.20 °C

Max temp (day)25.0 °C 18.3–30.2

Min temp (night)15.2 °C 9.90–19.9

Precipitation22.3 mm/mo 13.3–53.2

Air humidity56.1 % 50.0–58.8

Moisture balance-114 mm/mo -176–-52.3

Vapour deficit984 Pa 740–1,378

Wind speed3.70 m/s 2.80–5.00

Cloud cover14.0 % 7.80–19.4

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)