Antigonia rubicunda

Ogilby, 1910 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Caproidae/Antigonia

At a glance

Occurrence records1 042

Data sources6

Biological traits6

DNA specimens12

eDNA detections0

Sources6 archives

Databases and archives Antigonia rubicunda's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility521 records↗

OBISOcean Biodiversity Information System521 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 042 records

DNA & barcodingBOLD12 specimens

01Narrative

Antigonia rubicunda is een straalvinnige vissensoort uit de familie van evervissen (Caproidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1910 door Ogilby.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10.6 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Other traits3

Depth max340 m

Depth min125 m

Vulnerability10

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antigonia rubicunda has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

16Tmostly conserved

37Gmostly conserved

46Tmostly conserved

47Cmostly conserved

82Tmostly conserved

85Amostly conserved

100Tmostly conserved

112Cvariable

118Tmostly conserved

130Amostly conserved

163Amostly conserved

172Gmostly conserved

181Amostly conserved

184Cmostly conserved

196Gmostly conserved

199Tmostly conserved

208Amostly conserved

211Tmostly conserved

214Amostly conserved

223Cmostly conserved

226Amostly conserved

232Cmostly conserved

250Amostly conserved

259Amostly conserved

262Gmostly conserved

265Amostly conserved

268Amostly conserved

277Cmostly conserved

286Cmostly conserved

310Gvariable

313Gmostly conserved

316Gmostly conserved

325Gvariable

328Gmostly conserved

337Cmostly conserved

346Gmostly conserved

356Cmostly conserved

370Amostly conserved

376Amostly conserved

391Tmostly conserved

398Tmostly conserved

400Amostly conserved

403Tmostly conserved

406Gmostly conserved

412Amostly conserved

413Amostly conserved

427Tmostly conserved

433Cmostly conserved

436Cmostly conserved

445Cmostly conserved

460Tmostly conserved

463Gmostly conserved

469Cmostly conserved

475Amostly conserved

478Cmostly conserved

484Gmostly conserved

493Gmostly conserved

508Amostly conserved

514Amostly conserved

515Tmostly conserved

529Amostly conserved

538Cmostly conserved

541Cmostly conserved

562Cmostly conserved

565Amostly conserved

568Tmostly conserved

577Cmostly conserved

580Tmostly conserved

586Cmostly conserved

616Amostly conserved

628Amostly conserved

634Amostly conserved

643Cmostly conserved

649Tmostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGCTATAGTGGGCACAGCTCTAAGCTTACTTATCCGAGCTGAACTGAGCCAACCTGGAGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes3

BINs3

Most divergent pair0.61%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antigonia caprossame genus6.4%Antigonia indicasame genus7.1%Antigonia ovalissame genus7.5%Antigonia rubescenssame genus7.7%Antigonia malayanasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 042 records

Wild obs. + sensor651

Museum / vouchered391

Range

Area of Occupancy AOO1 016 km²

Depth

0–200 m sunlit323

200–1000 m twilight11

1–4 km midnight0

>4 km abyssal0

median 116.8 m · max 312 m · 334 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 650>10 km 1

651 georeferenced

Open the mapobservation + sensor651

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 12≤1 km 28≤10 km 90>10 km 3

133 georeferenced · 258 without coordinates

Open the institutions mapphysical evidence391

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	85
Sydney, AU	58
Australian National Fish Collectionlocation not on record	16
Paris, FR	15
Natick, US	11
CASlocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
South Kensington, GB	1

9 institutions · 190 of 391 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antigonia rubicunda

At a glance

Sources6 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type1 042 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Record type1 042 records