Antigius attilia

(Bremer, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Antigius

At a glance

Occurrence records331

Data sources7

Biological traits0

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Antigius attilia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility331 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF331 records

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT2n = 50

01Narrative

Antigius attilia is a butterfly of the family Lycaenidae. It is widespread from Japan, the Korean Peninsula, the Russian Far East throughout northern, central and western China to Taiwan. The wingspan is 14 –. The larvae feed on Quercus serrata, Quercus acutissima, Quercus variabilis, Quercus mongolica, Quercus dentate and Quercus aliena. Subspecies yamanakashoji has been recorded on Quercus acutissima.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antigius attilia has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

171Cvariable

204Avariable

205Cvariable

213Amostly conserved

312Cvariable

333Avariable

385Cvariable

541Cvariable

561Cvariable

585Avariable

618Avariable

ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCATTAAGAATTTTAATTCGAATAGAGTTAGGAACTCCTGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes3

BINs2

Most divergent pair1.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Japonica saepestriatasame family6.1%Satyrium w-albumsame family6.6%Japonica luteasame family6.6%Superflua sassanidessame family6.7%Arzecla tucumanensissame family6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Antigius attilia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 251×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 501×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type331 records

Wild obs. + sensor170

Museum / vouchered161

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 51≤1 km 27≤10 km 10>10 km 21

109 georeferenced · 61 without coordinates

Open the mapobservation + sensor170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 7≤10 km 3>10 km 11

21 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Obihiro Centennial City Museumlocation not on record	43
Toyota city nature sanctuarylocation not on record	36
YONElocation not on record	17
Kawasaki Shi Tama Ku, JP	14
Cambridge, US	10
Tokushima, JP	10
RCMlocation not on record	9
Tartu, EE	7
Natural History Museum of Utahlocation not on record	3
Yokosuka City Museumlocation not on record	3
Kushiro City Museumlocation not on record	3
Sanda, JP	2
MJINlocation not on record	2
New Haven, US	1
KCMNlocation not on record	1

15 institutions · 161 of 161 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)