Antidesma acidum

Retz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Antidesma

At a glance

Occurrence records487

Data sources8

Biological traits44

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Antidesma acidum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility487 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources44 traits

Occurrence & distributionGBIF487 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Antidesma acidum is a shrub or small tree that is native to an area from Jawa to south-central China and Pakistan. It is a long-lived, shade-tolerant species that is usually found under closed-canopy. The fruit is eaten in many places, the leaves in some locations. In Luang Prabang (Laos) open-air markets, the leaves are only sold alongside Russula mushrooms, to give a sour flavour to soup made from the fungi.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length4.75 mm

Fruit length max5.5 mm

Fruit length min4 mm

Inflorescence length max9 cm

Inflorescence length min2 cm

Leaf length120 mm

Leaf length max210 mm

Leaf length min30 mm

Leaf size3 250 mm²

Leaf width52.5 mm

Leaf width max90 mm

Leaf width min15 mm

Plant height5.5 m

Plant height max6 m

Plant height min2 m

Seed mass7.58 mg

Life cycle & reproduction5

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 500 m

Elevation mean820 m

Elevation min140 m

Epiphyteterrestrial

Growth formtree

Leaf formelliptic

Woodinesswoody

Physiology & chemistry7

Leaf c388 mg/g

Leaf dry-matter content (LDMC)234 mg/g

Leaf n14.93 mg/g

Leaf p2.69 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)13.12 mm²/mg

Other traits6

Leaf marginfinely toothed

Leaf spinesno

Leaf thornsno

Plant support typefree-standing

Sla max13.12 mm²/mg

Sla min13.12 mm²/mg

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antidesma acidum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPX899749.1 ↗504 bpIndia · 2025

ACGT

TATTATACTCCGGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCA …

Antidesma acidum isolate L4R ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Antidesma acidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Hans, A.S. 1969 ; Hans. A.S. 1970a

n 132×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MEHRA, P.N., & A.S. HANS. 1969. In IOPB chromosome number reports XXI. Taxon 18: 310-315.

CCDB · book-ipcn67-71 — HANS, A.S. 1970. Polyploidy in Antidesma (Euphorbiaceae). Caryologia 23: 321-327.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type487 records

Wild obs. + sensor17

Museum / vouchered470

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 15 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 1≤1 km 1≤10 km 5

7 georeferenced · 463 without coordinates

Open the institutions mapphysical evidence470

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	169
Beijing, CN	82
Guangzhou, CN	25
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	19
Kew, GB	12
Yangling, CN	6
Xiamen, CN	4
Dehra Dun, IN	4
Philadelphia, US	3
Guilin, CN	3
Uppsala, SE	3
Southwest Forestry Collegelocation not on record	2
University of Stellenboschlocation not on record	2
Chengdu, CN	2
Paris, FR	1
hitbclocation not on record	1
Baroda, IN	1
CASlocation not on record	1
Kagoshima, JP	1
Beijing, CN	1
Edinburgh, GB	1

21 institutions · 343 of 470 vouchered records shown · 127 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)