Anticlea vasiliata

Guenée · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Anticlea

At a glance

Occurrence records4 041

Data sources7

Biological traits0

DNA specimens116

eDNA detections111

Sources7 archives

Databases and archives Anticlea vasiliata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 041 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI111 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics116 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 041 records

Environmental DNA1 datasets · 2 countries111 detections

DNA & barcodingBOLD116 specimens

01Narrative

Anticlea vasiliata, the variable carpet moth or early carpet, is a moth of the family Geometridae. The species was first described by Achille Guenée in 1857. It is known from the northern part of the United States and southern Canada, from Newfoundland and Labrador to Maryland, west to California, north to British Columbia. The wingspan is about 30 mm. It can be distinguished by the combination of a short dark streak at the apex and a protruding double loop mid-way along the postmedial line on the forewings. There usually is a white spot halfway along the subterminal line. Adults are on wing from April to June. The larvae feed on Rubus idaeus and Rosa carolina.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding116 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anticlea vasiliata has left across the world's sequence archives.

At a glance

DNA specimens116

BINs1

Marker genes1

eDNA detections111

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus97 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

23Amostly conserved

28Gvariable

100Avariable

628Amostly conserved

AACATTATATTTTATTTTTGGTATTTGGGCAGGAATAATCGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes5

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euphyia intermediatasame family8.5%Eois olivaceasame family8.7%Nebula corticalissame family8.8%Euphyia unangulatasame family9.0%Scopula oppertasame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 041 records

Wild obs. + sensor3 424

Museum / vouchered617

Range

Area of Occupancy AOO4 956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 989≤1 km 432≤10 km 110>10 km 146

2 677 georeferenced · 747 without coordinates

Open the mapobservation + sensor3 424

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 8≤1 km 97≤10 km 190>10 km 17

312 georeferenced · 305 without coordinates

Open the institutions mapphysical evidence617

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	127
University of Alberta Museums (UAM)location not on record	126
Colorado State Universitylocation not on record	58
East Lansing, US	57
University of Guelph, Centre for Biodiversity Genomicslocation not on record	37
ASUlocation not on record	21
Cambridge, US	18
Edmonton, CA	15
Cleveland Museum of Natural History, OH (CLEV)location not on record	14
Cornell University Insect Collectionlocation not on record	10
Chicago, US	6
St. Paul, US	5
SOVTlocation not on record	5
Centre for Biodiversity Genomicslocation not on record	5
Royal Saskatchewan Museumlocation not on record	5
North Carolina State University Insect Museumlocation not on record	5
Vernal, US	4
Toronto, CA	3
UDlocation not on record	3
Tartu, EE	2
University of Alaska Museumlocation not on record	1

21 institutions · 527 of 617 vouchered records shown · 90 without an institution code

09Environmental DNA111 detections

Where the DNA of Anticlea vasiliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found111

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 111 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestTemperate mixed forestMixed habitatMixed HabitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.00 °C 5.20–15.6

Seasonal swing summer↔winter24.1 °C

Max temp (day)13.7 °C 10.1–19.0

Min temp (night)4.10 °C 0.1–10.6

Precipitation84.5 mm/mo 51.4–140

Air humidity58.3 % 52.1–62.9

Moisture balance-7.40 mm/mo -49.4–74.5

Vapour deficit490 Pa 374–773

Wind speed2.80 m/s 1.10–4.80

Cloud cover45.5 % 41.2–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 110 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anticlea vasiliata

At a glance

Sources7 archives

At a glance

Record type4 041 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 041 records