Anticla antica

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Bombycidae/Anticla

At a glance

Occurrence records1 821

Data sources6

Biological traits0

DNA specimens18

eDNA detections1

Sources6 archives

Databases and archives Anticla antica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 821 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 821 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD18 specimens

01Narrative

Anticla antica is a moth in the family Bombycidae. It was described by Francis Walker in 1855. It is found in Venezuela.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anticla antica has left across the world's sequence archives.

At a glance

DNA specimens18

BINs5

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.3%

Haplotypes2

BINs5

Most divergent pair4.6%

Where individuals differ — all 54 variable positions, in barcode order

5Tmostly conserved

34Avariable

43Amostly conserved

49Avariable

50Tmostly conserved

55Avariable

79Amostly conserved

82Cmostly conserved

88Cvariable

91Amostly conserved

118Tvariable

142Tvariable

163Tmostly conserved

205Tmostly conserved

220Cmostly conserved

235Cmostly conserved

259Tvariable

262Amostly conserved

263Tvariable

265Amostly conserved

266Tvariable

271Cvariable

274Avariable

280Tvariable

295Avariable

349Gmostly conserved

358Tmostly conserved

361Tmostly conserved

364Amostly conserved

367Tmostly conserved

368Gvariable

379Avariable

391Amostly conserved

397Tmostly conserved

400Avariable

412Tvariable

415Avariable

451Cvariable

460Tmostly conserved

494Cvariable

500Cvariable

529Tvariable

533Tvariable

542Cvariable

544Amostly conserved

571Tvariable

574Tvariable

596Tvariable

616Cvariable

622Tmostly conserved

625Tvariable

628Gmostly conserved

631Amostly conserved

646Tvariable

AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anticla ortygiasame genus2.3%Anticla flavariasame genus5.0%Quentalia excisasame family5.7%Quentalia denticulatasame family6.1%Renodes lituratasame order7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 821 records

Wild obs. + sensor311

Museum / vouchered1 510

Range

Area of Occupancy AOO932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 107≤1 km 71≤10 km 16>10 km 4

198 georeferenced · 113 without coordinates

Open the mapobservation + sensor311

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 509 without coordinates

Open the institutions mapphysical evidence1 510

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	1 493
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Smithsonian Tropical Research Institutelocation not on record	3
New Haven, US	1
Mississippi State, US	1
University of Pennsylvanialocation not on record	1

6 institutions · 1 510 of 1 510 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Anticla antica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 26.2–26.2

Seasonal swing summer↔winter1.00 °C

Max temp (day)29.6 °C

Min temp (night)23.7 °C

Precipitation43.3 mm/mo

Air humidity62.9 %

Moisture balance-133 mm/mo

Vapour deficit1,259 Pa

Wind speed3.90 m/s

Cloud cover12.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anticla antica

At a glance

Sources6 archives

At a glance

Record type1 821 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 821 records