Anticarsia irrorata

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anticarsia

At a glance

Occurrence records593

Data sources6

Biological traits0

DNA specimens68

eDNA detections63

Sources6 archives

Databases and archives Anticarsia irrorata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility593 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF593 records

Environmental DNA2 datasets · 17 countries63 detections

DNA & barcodingBOLD68 specimens

01Narrative

Anticarsia irrorata, the owl moth, is a species of moth in the family Noctuidae.Anticarsia irrorata, Owl Moth. Cook Islands Biodiversity Database. The Cook Islands Natural Heritage Trust. It is native to the Old World tropics.Anticarsia irrorata. The Moths of Borneo

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anticarsia irrorata has left across the world's sequence archives.

At a glance

DNA specimens68

BINs4

Marker genes2

eDNA detections63

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

4Amostly conserved

22Tvariable

34Amostly conserved

40Amostly conserved

49Amostly conserved

55Tmostly conserved

70Tmostly conserved

81Amostly conserved

82Tvariable

91Avariable

92Tmostly conserved

130Amostly conserved

133Tmostly conserved

139Tmostly conserved

142Tmostly conserved

200Gmostly conserved

202Amostly conserved

206Cmostly conserved

208Tmostly conserved

223Cvariable

232Tmostly conserved

238Tmostly conserved

259Tmostly conserved

263Tmostly conserved

265Amostly conserved

278Tmostly conserved

283Tmostly conserved

286Tmostly conserved

298Tmostly conserved

304Tmostly conserved

313Tmostly conserved

319Amostly conserved

325Amostly conserved

337Tmostly conserved

346Amostly conserved

347Cmostly conserved

349Tmostly conserved

352Tmostly conserved

364Cmostly conserved

367Tmostly conserved

391Tmostly conserved

397Tvariable

400Cvariable

403Tmostly conserved

406Cvariable

409Amostly conserved

415Tmostly conserved

421Cvariable

424Amostly conserved

433Tmostly conserved

436Tmostly conserved

439Tmostly conserved

445Cvariable

448Tmostly conserved

449Amostly conserved

460Tmostly conserved

484Amostly conserved

490Tmostly conserved

506Gmostly conserved

508Cvariable

514Tmostly conserved

517Tvariable

523Tmostly conserved

544Cvariable

547Amostly conserved

548Cvariable

553Tvariable

556Amostly conserved

562Avariable

565Amostly conserved

568Tmostly conserved

574Tvariable

578Tvariable

580Amostly conserved

581Tvariable

595Tmostly conserved

596Tmostly conserved

604Amostly conserved

607Tmostly conserved

616Tmostly conserved

619Tvariable

622Tvariable

634Tmostly conserved

637Amostly conserved

640Tmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes13

BINs4

Most divergent pair11.1%

OceaniaAfricaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Epitausa pronasame family5.8%Mormoscopa sordescenssame family5.9%Rhesala fusiformissame family6.1%Mosopia eudoxusalissame family6.4%Catadoides punctatasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type593 records

Wild obs. + sensor432

Museum / vouchered161

Origin

Native8

Range

Area of Occupancy AOO1 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 140≤1 km 126≤10 km 28>10 km 24

318 georeferenced · 114 without coordinates

Open the mapobservation + sensor432

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 3≤10 km 18>10 km 1

24 georeferenced · 137 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	37
DPIlocation not on record	16
SUVlocation not on record	8
Universite Claude Bernard Lyon 1location not on record	7
New Haven, US	6
Durban Natural Science Museumlocation not on record	6
Auckland, NZ	6
ZSMlocation not on record	5
Cambridge, US	5
Museums Victorialocation not on record	5
Mangilao, GU	4
tesrilocation not on record	4
Washington, US	4
National Museums of Kenyalocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Tallinn, EE	2
Research Collection of Graeme V. Cockslocation not on record	1
Taiwan Forestry Research Institutelocation not on record	1
New Zealand Arthropod Collectionlocation not on record	1
MZLUlocation not on record	1
Laboratoire Biométrie et Biologie Evolutive, University Lyon 1location not on record	1
FACTlocation not on record	1
Sydney, AU	1

24 institutions · 129 of 161 vouchered records shown · 32 without an institution code

09Environmental DNA63 detections

Where the DNA of Anticarsia irrorata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found63

Studies independent surveys2

Countries17

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 63 detections have coordinates

Open the map17 countries0

Tropical rainforest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 20.8–26.7

Seasonal swing summer↔winter5.60 °C

Max temp (day)27.1 °C 24.1–29.6

Min temp (night)21.0 °C 17.0–25.6

Precipitation194 mm/mo 36.0–370

Air humidity64.3 % 57.5–70.9

Moisture balance57.2 mm/mo

Vapour deficit1,072 Pa 753–1,293

Wind speed2.70 m/s

Cloud cover39.7 % 23.5–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)