Antiblemma rufinans

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Antiblemma

At a glance

Occurrence records57

Data sources6

Biological traits0

DNA specimens24

eDNA detections26

Sources6 archives

Databases and archives Antiblemma rufinans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 5 countries26 detections

DNA & barcodingBOLD24 specimens

01Narrative

Antiblemma rufinans, the live oak antiblemma, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found in dry, sandy woodlands, barrens, and scrub forests of the southern Florida plain. It is also present in South America, Cuba and Jamaica. The larvae feed on live oak species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiblemma rufinans has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections26

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

1Tmostly conserved

37Amostly conserved

262Gmostly conserved

355Tmostly conserved

514Amostly conserved

559Gmostly conserved

TTTATATTTCATTTTTGGAATTTGAGCTGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGTTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes12

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hydrillodes plicaloidessame family7.2%Deinopa delinquenssame family7.5%Datana contractasame order8.1%Xenimpia chalepasame order8.1%Eulepidotis viridissimasame family8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor20

Museum / vouchered37

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 10≤1 km 1>10 km 6

17 georeferenced · 3 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 2≤10 km 13>10 km 9

24 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	11
New Haven, US	10
Paris, FR	2
The University of the West Indies, Trinidad and Tobagolocation not on record	2
Ciudad de México, MX	2
St. Paul, US	2
Philadelphia, US	1

7 institutions · 30 of 37 vouchered records shown · 7 without an institution code

09Environmental DNA26 detections

Where the DNA of Antiblemma rufinans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 22.3–25.1

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.4 °C 25.6–28.2

Min temp (night)21.0 °C 18.2–22.7

Precipitation306 mm/mo 43.5–371

Air humidity69.6 % 61.1–70.2

Moisture balance157 mm/mo -65.2–220

Vapour deficit883 Pa 873–1,058

Wind speed3.20 m/s 1.40–5.80

Cloud cover38.8 % 17.8–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)