Antiblemma fuscireticulata

Kaye, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Antiblemma

At a glance

Occurrence records109

Data sources4

Biological traits0

DNA specimens163

eDNA detections164

Sources4 archives

Databases and archives Antiblemma fuscireticulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility109 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI164 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics163 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF109 records

Environmental DNA1 datasets · 1 countries164 detections

DNA & barcodingBOLD163 specimens

01Narrative

Antiblemma fuscireticulata is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1901 door Kaye.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding163 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiblemma fuscireticulata has left across the world's sequence archives.

At a glance

DNA specimens163

BINs1

Marker genes2

eDNA detections164

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus159 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

220Cvariable

238Amostly conserved

364Tmostly conserved

400Tmostly conserved

403Tvariable

631Gvariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACATCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes19

BIN1

Most divergent pair2.0%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antiblemma borregasame genus8.7%Antiblemma anguineasame genus8.8%Raphia hybrissame order9.4%Gonodonta nutrixsame family9.6%Cyana sanguineasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type109 records

Wild obs. + sensor48

Museum / vouchered61

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 19≤1 km 14≤10 km 3>10 km 3

39 georeferenced · 9 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	50
University of Pennsylvanialocation not on record	5
The University of the West Indies, Trinidad and Tobagolocation not on record	2
MZLUlocation not on record	1

4 institutions · 58 of 61 vouchered records shown · 3 without an institution code

09Environmental DNA164 detections

Where the DNA of Antiblemma fuscireticulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found164

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 164 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 22.4–25.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.7 °C 25.5–27.7

Min temp (night)21.6 °C 18.7–22.8

Precipitation288 mm/mo 81.1–468

Air humidity70.8 % 65.5–75.5

Moisture balance158 mm/mo -54.4–334

Vapour deficit861 Pa 700–1,048

Wind speed2.30 m/s 1.10–4.70

Cloud cover31.5 % 15.6–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 146 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)