Antiblemma amarga

Schaus, 1911 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Antiblemma

At a glance

Occurrence records115

Data sources4

Biological traits0

DNA specimens10

eDNA detections1

Sources4 archives

Databases and archives Antiblemma amarga's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD10 specimens

01Narrative

Antiblemma amarga is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1911 door Schaus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiblemma amarga has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Diversity (π)9.5%

Haplotypes2

BINs3

Most divergent pair10.8%

Where individuals differ — all 117 variable positions, in barcode order

1Avariable

2Cvariable

3Tmostly conserved

5Tmostly conserved

6Amostly conserved

7Tmostly conserved

8Amostly conserved

12Tmostly conserved

13Amostly conserved

18Tmostly conserved

20Gmostly conserved

21Tmostly conserved

22Amostly conserved

25Tmostly conserved

26Gmostly conserved

27Amostly conserved

28Gmostly conserved

29Cmostly conserved

30Amostly conserved

32Gmostly conserved

34Amostly conserved

35Tmostly conserved

36Amostly conserved

37Gmostly conserved

38Tmostly conserved

39Amostly conserved

41Gmostly conserved

43Amostly conserved

44Cmostly conserved

45Tmostly conserved

46Tmostly conserved

47Cmostly conserved

48Avariable

49Tmostly conserved

50Tmostly conserved

52Amostly conserved

53Gmostly conserved

56Tmostly conserved

57Amostly conserved

59Tmostly conserved

61Amostly conserved

63Tmostly conserved

64Cmostly conserved

65Gmostly conserved

66Amostly conserved

67Gmostly conserved

68Cmostly conserved

69Tvariable

70Gmostly conserved

72Amostly conserved

73Tmostly conserved

74Tmostly conserved

75Gvariable

78Amostly conserved

84Tmostly conserved

99Amostly conserved

126Tmostly conserved

129Tmostly conserved

141Tmostly conserved

153Tmostly conserved

162Amostly conserved

186Cvariable

189Amostly conserved

201Avariable

204Tmostly conserved

211Tmostly conserved

213Amostly conserved

216Tmostly conserved

219Tmostly conserved

222Amostly conserved

225Tmostly conserved

234Cvariable

264Amostly conserved

270Cvariable

276Amostly conserved

283Cmostly conserved

285Tmostly conserved

297Avariable

303Cmostly conserved

336Tmostly conserved

339Cvariable

342Avariable

372Amostly conserved

375Cvariable

385Tmostly conserved

400Cvariable

402Amostly conserved

406Tmostly conserved

411Tmostly conserved

414Tmostly conserved

420Amostly conserved

423Tmostly conserved

432Tmostly conserved

438Tmostly conserved

450Cvariable

453Amostly conserved

468Amostly conserved

499Tmostly conserved

501Amostly conserved

505Gmostly conserved

507Tmostly conserved

525Tmostly conserved

538Tmostly conserved

540Amostly conserved

546Tmostly conserved

555Cmostly conserved

564Tmostly conserved

573Tmostly conserved

585Tmostly conserved

588Cvariable

595Cmostly conserved

597Tmostly conserved

606Amostly conserved

636Tvariable

642Tvariable

645Tvariable

651Tvariable

ACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTGGGAAATCCTGGATCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antiblemma fulvipictasame genus2.7%Antiblemma neptissame genus7.5%Antiblemma orbiculatasame genus7.5%Oxyodes scrobiculatasame family7.9%Gonuris flaminiasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor4

Museum / vouchered111

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 22

22 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	83
Cambridge, US	22
University of Pennsylvanialocation not on record	6

3 institutions · 111 of 111 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Antiblemma amarga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)